Ubuntu Manpage: sambamba-view - tool for extracting information from SAM/BAM/CRAM files

NAME

       sambamba-view - tool for extracting information from SAM/BAM/CRAM files

SYNOPSIS

       sambamba view OPTIONS <input.bam | input.sam | input.cram> [region1 [...]]

DESCRIPTION

       sambamba  view  allows  to efficiently filter SAM/BAM/CRAM files for alignments satisfying
       various conditions, as well as access its  SAM  header  and  information  about  reference
       sequences.  In  order  to  make these data readily available for consumption by scripts in
       Perl/Python/Ruby, JSON output is provided.

       By default, the tool expects BAM file as an input. In order to work with CRAM, specify  -C
       and  for  SAM,  specify  -S|--sam-input as a command-line option, the tool does NOT try to
       guess file format from the extension. Beware that when reading SAM,  the  tool  will  skip
       tags  which  don´t  conform  to the SAM/BAM specification, and set invalid fields to their
       default values.

FILTERING

       Filtering is presented in two ways. First, you can specify a  condition  with  -F  option,
       using a special language for filtering, described at

       https://github.com/lomereiter/sambamba/wiki/%5Bsambamba-view%5D-Filter-expression-syntax

       Second,  if  you  have  an indexed BAM file, several regions can be specified as well. The
       syntax for regions is the same as in samtools: chr:beg-end where beg and end  are  1-based
       start and end of a closed-end interval on the reference chr.

JSON

       Alignment  record JSON representation is a hash with keys ´qname´, ´flag´, ´rname´, ´pos´,
       ´mapq´, ´cigar´, ´rnext´, ´qual´, ´tags´, e.g.

       {"qname":"EAS56_57:6:190:289:82","flag":69,"rname":"chr1","pos":100,
       "mapq":0,"cigar":"*","rnext":"=","pnext":100,"tlen":0,
       "seq":"CTCAAGGTTGTTGCAAGGGGGTCTATGTGAACAAA",
       "qual":[27,27,27,22,27,27,27,26,27,27,27,27,27,27,27,27,23,26,26,27,
       22,26,19,27,26,27,26,26,26,26,26,24,19,27,26],"tags":{"MF":192}}

       JSON representation mimics SAM format except quality is given as an array of integers.

       Postprocessing JSON output is best accomplished with https://stedolan.github.io/jq/

       The output is one line per read, for building a proper JSON array pipe the output into  jq
       --slurp.

OPTIONS

-F, --filter=FILTER
Set custom filter for alignments.

-f, --format=FORMAT
Specify output format. FORMAT must be one of sam, bam, cram, or json (in
lowercase). Default is SAM.

-h, --with-header
Print SAM header before reads. This is always done for BAM output.

-H, --header
Print only SAM header to STDOUT. If FORMAT is sam or bam, its text version is
printed, otherwise JSON object is written.

-I, --reference-info
Output to STDOUT reference sequence names and lengths in JSON (see EXAMPLES).

-L, --regions=BEDFILE
Intersect a file with regions specified in the BED file.

-c, --count
Output to STDOUT only the number of matching records, -hHI options are ignored.

-v, --valid
Output only valid reads.

-S, --sam-input
Specify that the input is SAM file (default is BAM for all operations).

-C, --cram-input
Specify that input is in CRAM format

-p, --show-progress
Show progressbar in STDERR. Works only for BAM files, and with no regions
specified, i.e. only when reading full file.

-l, --compression-level=COMPRESSION_LEVEL
Set compression level for BAM output, a number from 0 to 9.

-o, --output-filename=FILENAME
Specify output filename (by default everything is written to STDOUT).

-t, --nthreads=NTHREADS
Number of threads to use.

EXAMPLES

       Print basic reference sequence information:

            $ sambamba view --reference-info ex1_header.bam
            [{"name":"chr1","length":1575},{"name":"chr2","length":1584}]

       Count reads with mapping quality not less than 50:

            $ sambamba view -c -F "mapping_quality >= 50" ex1_header.bam
            3124

       Count properly paired reads overlapping 100..200 on chr1:

            $ sambamba view -c -F "proper_pair" ex1_header.bam chr1:100-200
            39

       Output header in JSON format:

            $ sambamba view --header --format=json ex1_header.bam
            {"format_version":"1.3","rg_lines":[],
             "sq_lines":[{"sequence_length":1575,"species":"","uri":"",
             "sequence_name":"chr1","assembly":"","md5":""},
             {"sequence_length":1584,"species":"","uri":"",
             "sequence_name":"chr2","assembly":"","md5":""}],
             "sorting_order":"coordinate","pg_lines":[]}