Provided by: libbio-perl-run-perl_1.7.1-3_all 
NAME
Bio::Tools::Run::StandAloneBlast - Object for the local execution of the NCBI BLAST
program suite (blastall, blastpgp, bl2seq). There is experimental support for WU-Blast
and NCBI rpsblast.
SYNOPSIS
# Local-blast "factory object" creation and blast-parameter
# initialization:
@params = (-database => 'swissprot', -outfile => 'blast1.out');
$factory = Bio::Tools::Run::StandAloneBlast->new(@params);
# Blast a sequence against a database:
$str = Bio::SeqIO->new(-file=>'t/amino.fa', -format => 'Fasta');
$input = $str->next_seq();
$input2 = $str->next_seq();
$blast_report = $factory->blastall($input);
# Run an iterated Blast (psiblast) of a sequence against a database:
$factory->j(3); # 'j' is blast parameter for # of iterations
$factory->outfile('psiblast1.out');
$factory = Bio::Tools::Run::StandAloneBlast->new(@params);
$blast_report = $factory->blastpgp($input);
# Use blast to align 2 sequences against each other:
$factory = Bio::Tools::Run::StandAloneBlast->new(-outfile => 'bl2seq.out');
$factory->bl2seq($input, $input2);
# Experimental support for WU-Blast 2.0
my $factory = Bio::Tools::Run::StandAloneBlast->new(-program =>"wublastp",
-database =>"swissprot",
-e => 1e-20);
my $blast_report = $factory->wublast($seq);
# Experimental support for NCBI rpsblast
my $factory = Bio::Tools::Run::StandAloneBlast->new(-db => 'CDD/Cog',
-expect => 0.001);
$factory->F('T'); # turn on SEG filtering of query sequence
my $blast_report = $factory->rpsblast($seq);
# Use the experimental fast Blast parser, 'blast_pull'
my $factory = Bio::Tools::Run::StandAloneBlast->new(-_READMETHOD =>'blast_pull',
@other_params);
# Various additional options and input formats are available,
# see the DESCRIPTION section for details.
DESCRIPTION
This DESCRIPTION only documents Bio::Tools::Run::StandAloneBlast, a Bioperl object for
running the NCBI standAlone BLAST package. Blast itself is a large & complex program - for
more information regarding BLAST, please see the BLAST documentation which accompanies the
BLAST distribution. BLAST is available from ftp://ncbi.nlm.nih.gov/blast/.
A source of confusion in documenting a BLAST interface is that the term "program" is used
in - at least - three different ways in the BLAST documentation. In this DESCRIPTION,
"program" will refer to the BLAST routine set by the BLAST "-p" parameter that can be set
to blastn, blastp, tblastx etc. We will use the term Blast "executable" to refer to the
various different executable files that may be called - ie. blastall, blastpgp or bl2seq.
In addition, there are several BLAST capabilities, which are also referred to as
"programs", and are implemented by using specific combinations of BLAST executables,
programs and parameters. They will be referred by their specific names - eg PSIBLAST and
PHIBLAST.
Before running StandAloneBlast it is necessary: to install BLAST on your system, to edit
set the environmental variable $BLASTDIR or your $PATH variable to point to the BLAST
directory, and to ensure that users have execute privileges for the BLAST program.
If the databases which will be searched by BLAST are located in the data subdirectory of
the blast program directory (the default installation location), StandAloneBlast will find
them; however, if the database files are located in any other location, environmental
variable $BLASTDATADIR will need to be set to point to that directory.
The use of the StandAloneBlast module is as follows: Initially, a local blast "factory
object" is created. The constructor may be passed an optional array of (non-default)
parameters to be used by the factory, eg:
@params = (-program => 'blastn', -database => 'ecoli.nt');
$factory = Bio::Tools::Run::StandAloneBlast->new(@params);
Any parameters not explicitly set will remain as the defaults of the BLAST executable.
Note each BLAST executable has somewhat different parameters and options. See the BLAST
Documentation for a description or run the BLAST executable from the command line followed
solely with a "-" to see a list of options and default values for that executable; eg
>blastall -.
BLAST parameters can be changed and/or examined at any time after the factory has been
created. The program checks that any parameter/switch being set/read is valid. Except
where specifically noted, StandAloneBlast uses the same single-letter, case-sensitive
parameter names as the actual blast program. Currently no checks are included to verify
that parameters are of the proper type (e.g. string or numeric) or that their values are
within the proper range.
As an example, to change the value of the Blast parameter 'e' ('e' is the parameter for
expectation-value cutoff)
$expectvalue = 0.01;
$factory->e($expectvalue);
Note that for improved script readibility one can modify the name of the (ncbi) BLAST
parameters as desired as long as the initial letter (and case) of the parameter are
preserved, e.g.:
$factory->expectvalue($expectvalue);
Unfortunately, some of the BLAST parameters are not the single letter one might expect (eg
"iteration round" in blastpgp is 'j'). Again one can check by using, for example:
> blastpgp -
Wublast parameters need to be complete (ie. don't truncate them to their first letter),
but are case-insensitive.
Once the factory has been created and the appropriate parameters set, one can call one of
the supported blast executables. The input sequence(s) to these executables may be fasta
file(s) as described in the BLAST documentation.
$inputfilename = 't/testquery.fa';
$blast_report = $factory->blastall($inputfilename);
In addition, sequence input may be in the form of either a Bio::Seq object or (a reference
to) an array of Bio::Seq objects, e.g.:
$input = Bio::Seq->new(-id => "test query",
-seq => "ACTACCCTTTAAATCAGTGGGGG");
$blast_report = $factory->blastall($input);
NOTE: Use of the BPlite method has been deprecated and is no longer supported.
For blastall and non-psiblast blastpgp runs, report object is a Bio::SearchIO object,
selected by the user with the parameter _READMETHOD. The leading underscore is needed to
distinguish this option from options which are passed to the BLAST executable. The default
parser is Bio::SearchIO::blast. In any case, the "raw" blast report is also available. The
filename is set by the 'outfile' parameter and has the default value of "blastreport.out".
For psiblast execution in the BLAST "jumpstart" mode, the program must be passed (in
addition to the query sequence itself) an alignment containing the query sequence (in the
form of a SimpleAlign object) as well as a "mask" specifying at what residues position-
specific scoring matrices (PSSMs) are to used and at what residues default scoring
matrices (eg BLOSUM) are to be used. See psiblast documentation for more details. The mask
itself is a string of 0's and 1's which is the same length as each sequence in the
alignment and has a "1" at locations where (PSSMs) are to be used and a "0" at all other
locations. So for example:
$str = Bio::AlignIO->new(-file => "cysprot.msf",
-format => 'msf');
$aln = $str->next_aln();
$len = $aln->length_aln();
$mask = '1' x $len;
# simple case where PSSM's to be used at all residues
$report = $factory->blastpgp("cysprot1.fa", $aln, $mask);
For bl2seq execution, StandAloneBlast.pm can be combined with AlignIO.pm to directly
produce a SimpleAlign object from the alignment of the two sequences produced by bl2seq as
in:
# Get 2 sequences
$str = Bio::SeqIO->new(-file=>'t/amino.fa' , -format => 'Fasta');
my $seq3 = $str->next_seq();
my $seq4 = $str->next_seq();
# Run bl2seq on them
$factory = Bio::Tools::Run::StandAloneBlast->new(-program => 'blastp',
-outfile => 'bl2seq.out');
my $bl2seq_report = $factory->bl2seq($seq3, $seq4);
# Use AlignIO.pm to create a SimpleAlign object from the bl2seq report
$str = Bio::AlignIO->new(-file=> 'bl2seq.out',-format => 'bl2seq');
$aln = $str->next_aln();
For more examples of syntax and use of StandAloneBlast.pm, the user is encouraged to run
the scripts standaloneblast.pl in the bioperl examples/tools directory and
StandAloneBlast.t in the bioperl t/ directory.
FEEDBACK
Mailing Lists
User feedback is an integral part of the evolution of this and other Bioperl modules. Send
your comments and suggestions preferably to one of the Bioperl mailing lists. Your
participation is much appreciated.
bioperl-l@bioperl.org - General discussion
http://bioperl.org/wiki/Mailing_lists - About the mailing lists
Support
Please direct usage questions or support issues to the mailing list:
bioperl-l@bioperl.org
rather than to the module maintainer directly. Many experienced and reponsive experts will
be able look at the problem and quickly address it. Please include a thorough description
of the problem with code and data examples if at all possible.
Reporting Bugs
Report bugs to the Bioperl bug tracking system to help us keep track the bugs and their
resolution. Bug reports can be submitted via the web:
https://github.com/bioperl/bioperl-live/issues
AUTHOR - Peter Schattner
Email schattner at alum.mit.edu
MAINTAINER - Torsten Seemann
Email torsten at infotech.monash.edu.au
CONTRIBUTORS
Sendu Bala bix@sendu.me.uk (reimplementation)
APPENDIX
The rest of the documentation details each of the object methods. Internal methods are
usually preceded with a _
new
Title : new
Usage : my $obj = Bio::Tools::Run::StandAloneBlast->new();
Function: Builds a newBio::Tools::Run::StandAloneBlast object
Returns : Bio::Tools::Run::StandAloneNCBIBlast or StandAloneWUBlast
Args : -quiet => boolean # make program execution quiet
-_READMETHOD => 'BLAST' (default, synonym 'SearchIO') || 'blast_pull'
# the parsing method, case insensitive
Essentially all BLAST parameters can be set via StandAloneBlast.pm. Some of the most
commonly used parameters are listed below. All parameters have defaults and are optional
except for -p in those programs that have it. For a complete listing of settable
parameters, run the relevant executable BLAST program with the option "-" as in blastall -
Note that the input parameters (-i, -j, -input) should not be set directly by you: this
module sets them when you call one of the executable methods.
Blastall
-p Program Name [String]
Input should be one of "blastp", "blastn", "blastx",
"tblastn", or "tblastx".
-d Database [String] default = nr
The database specified must first be formatted with formatdb.
Multiple database names (bracketed by quotations) will be accepted.
An example would be -d "nr est"
-e Expectation value (E) [Real] default = 10.0
-o BLAST report Output File [File Out] Optional,
default = ./blastreport.out ; set by StandAloneBlast.pm
-S Query strands to search against database (for blast[nx], and tblastx). 3 is both, 1 is top, 2 is bottom [Integer]
default = 3
Blastpgp (including Psiblast)
-j is the maximum number of rounds (default 1; i.e., regular BLAST)
-h is the e-value threshold for including sequences in the
score matrix model (default 0.001)
-c is the "constant" used in the pseudocount formula specified in the paper (default 10)
-B Multiple alignment file for PSI-BLAST "jump start mode" Optional
-Q Output File for PSI-BLAST Matrix in ASCII [File Out] Optional
rpsblast
-d Database [String] default = (none - you must specify a database)
The database specified must first be formatted with formatdb.
Multiple database names (bracketed by quotations) will be accepted.
An example would be -d "Cog Smart"
-e Expectation value (E) [Real] default = 10.0
-o BLAST report Output File [File Out] Optional,
default = ./blastreport.out ; set by StandAloneBlast.pm
Bl2seq
-p Program name: blastp, blastn, blastx. For blastx 1st argument should be nucleotide [String]
default = blastp
-o alignment output file [File Out] default = stdout
-e Expectation value (E) [Real] default = 10.0
-S Query strands to search against database (blastn only). 3 is both, 1 is top, 2 is bottom [Integer]
default = 3
WU-Blast
-p Program Name [String]
Input should be one of "wublastp", "wublastn", "wublastx",
"wutblastn", or "wutblastx".
-d Database [String] default = nr
The database specified must first be formatted with xdformat.
-E Expectation value (E) [Real] default = 10.0
-o BLAST report Output File [File Out] Optional,
default = ./blastreport.out ; set by StandAloneBlast.pm
executable
Title : executable
Usage : my $exe = $blastfactory->executable('blastall');
Function: Finds the full path to the executable
Returns : string representing the full path to the exe
Args : [optional] name of executable to set path to
[optional] boolean flag whether or not warn when exe is not found
program_dir
Title : program_dir
Usage : my $dir = $factory->program_dir();
Function: Abstract get method for dir of program.
Returns : string representing program directory
Args : none
_setinput
Title : _setinput
Usage : Internal function, not to be called directly
Function: Create input file(s) for Blast executable
Example :
Returns : name of file containing Blast data input
Args : Seq object reference or input file name
Bio::Tools::Run::WrapperBase methods
no_param_checks
Title : no_param_checks
Usage : $obj->no_param_checks($newval)
Function: Boolean flag as to whether or not we should
trust the sanity checks for parameter values
Returns : value of no_param_checks
Args : newvalue (optional)
save_tempfiles
Title : save_tempfiles
Usage : $obj->save_tempfiles($newval)
Function:
Returns : value of save_tempfiles
Args : newvalue (optional)
outfile_name
Title : outfile_name
Usage : my $outfile = $tcoffee->outfile_name();
Function: Get/Set the name of the output file for this run
(if you wanted to do something special)
Returns : string
Args : [optional] string to set value to
tempdir
Title : tempdir
Usage : my $tmpdir = $self->tempdir();
Function: Retrieve a temporary directory name (which is created)
Returns : string which is the name of the temporary directory
Args : none
cleanup
Title : cleanup
Usage : $tcoffee->cleanup();
Function: Will cleanup the tempdir directory after a PAML run
Returns : none
Args : none
io
Title : io
Usage : $obj->io($newval)
Function: Gets a Bio::Root::IO object
Returns : Bio::Root::IO
Args : none