Provided by: emboss_6.6.0+dfsg-7_amd64 bug

NAME

       eprimer3 - Picks PCR primers and hybridization oligos

SYNOPSIS

       eprimer3 -sequence seqall [-primer toggle] -task list [-hybridprobe toggle]
                -mishyblibraryfile infile -mispriminglibraryfile infile [-numreturn integer]
                [-includedregion range] [-targetregion range] [-excludedregion range]
                [-forwardinput string] [-reverseinput string] -gcclamp integer -osize integer
                -minsize integer -maxsize integer -otm float -mintm float -maxtm float
                -maxdifftm float -ogcpercent float -mingc float -maxgc float -saltconc float
                -dnaconc float -maxpolyx integer -psizeopt integer -prange range -ptmopt float
                -ptmmin float -ptmmax float -oexcludedregion range -oligoinput string
                -osizeopt integer -ominsize integer -omaxsize integer -otmopt float -otmmin float
                -otmmax float -ogcopt float -ogcmin float -ogcmax float -osaltconc float
                -odnaconc float -oanyself float -oendself float -opolyxmax integer
                -omishybmax float -explainflag boolean -fileflag boolean -firstbaseindex integer
                -pickanyway boolean -maxmispriming float -pairmaxmispriming float
                -numnsaccepted integer -selfany float -selfend float -maxendstability float
                -outfile outfile

       eprimer3 -help

DESCRIPTION

       eprimer3 is a command line program from EMBOSS (“the European Molecular Biology Open
       Software Suite”). It is part of the "Nucleic:Primers" command group(s).

OPTIONS

   Input section
       -sequence seqall
           The sequence from which to choose primers. The sequence must be presented 5' to 3'

       -primer toggle
           Tell EPrimer3 to pick primer(s) Default value: Y

       -task list
           Tell EPrimer3 what task to perform. Legal values are 1: 'Pick PCR primers', 2: 'Pick
           forward primer only', 3: 'Pick reverse primer only', 4: 'No primers needed'. Default
           value: 1

       -hybridprobe toggle
           An 'internal oligo' is intended to be used as a hybridization probe (hyb probe) to
           detect the PCR product after amplification. Default value: N

       -mishyblibraryfile infile
           Similar to MISPRIMING-LIBRARY, except that the event we seek to avoid is hybridization
           of the internal oligo to sequences in this library rather than priming from them. The
           file must be in (a slightly restricted) FASTA format (W. B. Pearson and D.J. Lipman,
           PNAS 85:8 pp 2444-2448 [1988]); we briefly discuss the organization of this file
           below. If this parameter is specified then EPrimer3 locally aligns each candidate
           oligo against each library sequence and rejects those primers for which the local
           alignment score times a specified weight (see below) exceeds
           INTERNAL-OLIGO-MAX-MISHYB. (The maximum value of the weight is arbitrarily set to
           12.0.) Each sequence entry in the FASTA-format file must begin with an 'id line' that
           starts with '>'. The contents of the id line is 'slightly restricted' in that EPrimer3
           parses everything after any optional asterisk ('*') as a floating point number to use
           as the weight mentioned above. If the id line contains no asterisk then the weight
           defaults to 1.0. The alignment scoring system used is the same as for calculating
           complementarity among oligos (e.g. SELF-ANY). The remainder of an entry contains the
           sequence as lines following the id line up until a line starting with '>' or the end
           of the file. Whitespace and newlines are ignored. Characters 'A', 'T', 'G', 'C', 'a',
           't', 'g', 'c' are retained and any other character is converted to 'N' (with the
           consequence that any IUB / IUPAC codes for ambiguous bases are converted to 'N').
           There are no restrictions on line length. An empty value for this parameter indicates
           that no library should be used.

       -mispriminglibraryfile infile
           The name of a file containing a nucleotide sequence library of sequences to avoid
           amplifying (for example repetitive sequences, or possibly the sequences of genes in a
           gene family that should not be amplified.) The file must be in (a slightly restricted)
           FASTA format (W. B. Pearson and D.J. Lipman, PNAS 85:8 pp 2444-2448 [1988]); we
           briefly discuss the organization of this file below. If this parameter is specified
           then EPrimer3 locally aligns each candidate primer against each library sequence and
           rejects those primers for which the local alignment score times a specified weight
           (see below) exceeds MAX-MISPRIMING. (The maximum value of the weight is arbitrarily
           set to 100.0.) Each sequence entry in the FASTA-format file must begin with an 'id
           line' that starts with '>'. The contents of the id line is 'slightly restricted' in
           that EPrimer3 parses everything after any optional asterisk ('*') as a floating point
           number to use as the weight mentioned above. If the id line contains no asterisk then
           the weight defaults to 1.0. The alignment scoring system used is the same as for
           calculating complementarity among oligos (e.g. SELF-ANY). The remainder of an entry
           contains the sequence as lines following the id line up until a line starting with '>'
           or the end of the file. Whitespace and newlines are ignored. Characters 'A', 'T', 'G',
           'C', 'a', 't', 'g', 'c' are retained and any other character is converted to 'N' (with
           the consequence that any IUB / IUPAC codes for ambiguous bases are converted to 'N').
           There are no restrictions on line length. An empty value for this parameter indicates
           that no repeat library should be used.

   Additional section
   Program options
       -numreturn integer
           The maximum number of primer pairs to return. Primer pairs returned are sorted by
           their 'quality', in other words by the value of the objective function (where a lower
           number indicates a better primer pair). Caution: setting this parameter to a large
           value will increase running time. Default value: 5

   Sequence options
       -includedregion range
           A sub-region of the given sequence in which to pick primers. For example, often the
           first dozen or so bases of a sequence are vector, and should be excluded from
           consideration. The value for this parameter has the form (start),(end) where (start)
           is the index of the first base to consider, and (end) is the last in the
           primer-picking region.

       -targetregion range
           If one or more Targets is specified then a legal primer pair must flank at least one
           of them. A Target might be a simple sequence repeat site (for example a CA repeat) or
           a single-base-pair polymorphism. The value should be a space-separated list of
           (start),(end) pairs where (start) is the index of the first base of a Target, and
           (end) is the last E.g. 50,51 requires primers to surround the 2 bases at positions 50
           and 51.

       -excludedregion range
           Primer oligos may not overlap any region specified in this tag. The associated value
           must be a space-separated list of (start),(end) pairs where (start) is the index of
           the first base of the excluded region, and and (end) is the last. This tag is useful
           for tasks such as excluding regions of low sequence quality or for excluding regions
           containing repetitive elements such as ALUs or LINEs. E.g. 401,407 68,70 forbids
           selection of primers in the 7 bases starting at 401 and the 3 bases at 68.

       -forwardinput string
           The sequence of a forward primer to check and around which to design reverse primers
           and optional internal oligos. Must be a substring of SEQUENCE.

       -reverseinput string
           The sequence of a reverse primer to check and around which to design forward primers
           and optional internal oligos. Must be a substring of the reverse strand of SEQUENCE.

   Primer options
       -gcclamp integer
           Require the specified number of consecutive Gs and Cs at the 3' end of both the
           forward and reverse primer. (This parameter has no effect on the internal oligo if one
           is requested.)

       -osize integer
           Optimum length (in bases) of a primer oligo. EPrimer3 will attempt to pick primers
           close to this length. Default value: 20

       -minsize integer
           Minimum acceptable length of a primer. Must be greater than 0 and less than or equal
           to MAX-SIZE. Default value: 18

       -maxsize integer
           Maximum acceptable length (in bases) of a primer. Currently this parameter cannot be
           larger than 35. This limit is governed by the maximum oligo size for which EPrimer3's
           melting-temperature is valid. Default value: 27

       -otm float
           Optimum melting temperature(Celsius) for a primer oligo. EPrimer3 will try to pick
           primers with melting temperatures are close to this temperature. The oligo melting
           temperature formula in EPrimer3 is that given in Rychlik, Spencer and Rhoads, Nucleic
           Acids Research, vol 18, num 21, pp 6409-6412 and Breslauer, Frank, Bloecker and Marky,
           Proc. Natl. Acad. Sci. USA, vol 83, pp 3746-3750. Please refer to the former paper for
           background discussion. Default value: 60.0

       -mintm float
           Minimum acceptable melting temperature(Celsius) for a primer oligo. Default value:
           57.0

       -maxtm float
           Maximum acceptable melting temperature(Celsius) for a primer oligo. Default value:
           63.0

       -maxdifftm float
           Maximum acceptable (unsigned) difference between the melting temperatures of the
           forward and reverse primers. Default value: 100.0

       -ogcpercent float
           Primer optimum GC percent. Default value: 50.0

       -mingc float
           Minimum allowable percentage of Gs and Cs in any primer. Default value: 20.0

       -maxgc float
           Maximum allowable percentage of Gs and Cs in any primer generated by Primer. Default
           value: 80.0

       -saltconc float
           The millimolar concentration of salt (usually KCl) in the PCR. EPrimer3 uses this
           argument to calculate oligo melting temperatures. Default value: 50.0

       -dnaconc float
           The nanomolar concentration of annealing oligos in the PCR. EPrimer3 uses this
           argument to calculate oligo melting temperatures. The default (50nM) works well with
           the standard protocol used at the Whitehead/MIT Center for Genome Research--0.5
           microliters of 20 micromolar concentration for each primer oligo in a 20 microliter
           reaction with 10 nanograms template, 0.025 units/microliter Taq polymerase in 0.1 mM
           each dNTP, 1.5mM MgCl2, 50mM KCl, 10mM Tris-HCL (pH 9.3) using 35 cycles with an
           annealing temperature of 56 degrees Celsius. This parameter corresponds to 'c' in
           Rychlik, Spencer and Rhoads' equation (ii) (Nucleic Acids Research, vol 18, num 21)
           where a suitable value (for a lower initial concentration of template) is 'empirically
           determined'. The value of this parameter is less than the actual concentration of
           oligos in the reaction because it is the concentration of annealing oligos, which in
           turn depends on the amount of template (including PCR product) in a given cycle. This
           concentration increases a great deal during a PCR; fortunately PCR seems quite robust
           for a variety of oligo melting temperatures. See ADVICE FOR PICKING PRIMERS. Default
           value: 50.0

       -maxpolyx integer
           The maximum allowable length of a mononucleotide repeat in a primer, for example
           AAAAAA. Default value: 5

   Product options
       -psizeopt integer
           The optimum size for the PCR product. 0 indicates that there is no optimum product
           size. Default value: 200

       -prange range
           The associated values specify the lengths of the product that the user wants the
           primers to create, and is a space separated list of elements of the form (x)-(y) where
           an (x)-(y) pair is a legal range of lengths for the product. For example, if one wants
           PCR products to be between 100 to 150 bases (inclusive) then one would set this
           parameter to 100-150. If one desires PCR products in either the range from 100 to 150
           bases or in the range from 200 to 250 bases then one would set this parameter to
           100-150 200-250. EPrimer3 favors ranges to the left side of the parameter string.
           EPrimer3 will return legal primers pairs in the first range regardless the value of
           the objective function for these pairs. Only if there are an insufficient number of
           primers in the first range will EPrimer3 return primers in a subsequent range. Default
           value: 100-300

       -ptmopt float
           The optimum melting temperature for the PCR product. 0 indicates that there is no
           optimum temperature. Default value: 0.0

       -ptmmin float
           The minimum allowed melting temperature of the amplicon. Please see the documentation
           on the maximum melting temperature of the product for details. Default value:
           -1000000.0

       -ptmmax float
           The maximum allowed melting temperature of the amplicon. Product Tm is calculated
           using the formula from Bolton and McCarthy, PNAS 84:1390 (1962) as presented in
           Sambrook, Fritsch and Maniatis, Molecular Cloning, p 11.46 (1989, CSHL Press). Tm =
           81.5 + 16.6(log10([Na+])) + .41*(%GC) - 600/length Where [Na+} is the molar sodium
           concentration, (%GC) is the percent of Gs and Cs in the sequence, and length is the
           length of the sequence. A similar formula is used by the prime primer selection
           program in GCG, which instead uses 675.0/length in the last term (after F. Baldino,
           Jr, M.-F. Chesselet, and M.E. Lewis, Methods in Enzymology 168:766 (1989) eqn (1) on
           page 766 without the mismatch and formamide terms). The formulas here and in Baldino
           et al. assume Na+ rather than K+. According to J.G. Wetmur, Critical Reviews in
           BioChem. and Mol. Bio. 26:227 (1991) 50 mM K+ should be equivalent in these formulae
           to .2 M Na+. EPrimer3 uses the same salt concentration value for calculating both the
           primer melting temperature and the oligo melting temperature. If you are planning to
           use the PCR product for hybridization later this behavior will not give you the Tm
           under hybridization conditions. Default value: 1000000.0

   Internal oligo input
       -oexcludedregion range
           Middle oligos may not overlap any region specified by this tag. The associated value
           must be a space-separated list of (start),(end) pairs, where (start) is the index of
           the first base of an excluded region, and (end) is the last. Often one would make
           Target regions excluded regions for internal oligos.

       -oligoinput string
           The sequence of an internal oligo to check and around which to design forward and
           reverse primers. Must be a substring of SEQUENCE.

   Internal oligo options
       -osizeopt integer
           Optimum length (in bases) of an internal oligo. EPrimer3 will attempt to pick primers
           close to this length. Default value: 20

       -ominsize integer
           Minimum acceptable length of an internal oligo. Must be greater than 0 and less than
           or equal to INTERNAL-OLIGO-MAX-SIZE. Default value: 18

       -omaxsize integer
           Maximum acceptable length (in bases) of an internal oligo. Currently this parameter
           cannot be larger than 35. This limit is governed by maximum oligo size for which
           EPrimer3's melting-temperature is valid. Default value: 27

       -otmopt float
           Optimum melting temperature (Celsius) for an internal oligo. EPrimer3 will try to pick
           oligos with melting temperatures that are close to this temperature. The oligo melting
           temperature formula in EPrimer3 is that given in Rychlik, Spencer and Rhoads, Nucleic
           Acids Research, vol 18, num 21, pp 6409-6412 and Breslauer, Frank, Bloecker and Marky,
           Proc. Natl. Acad. Sci. USA, vol 83, pp 3746-3750. Please refer to the former paper for
           background discussion. Default value: 60.0

       -otmmin float
           Minimum acceptable melting temperature(Celsius) for an internal oligo. Default value:
           57.0

       -otmmax float
           Maximum acceptable melting temperature (Celsius) for an internal oligo. Default value:
           63.0

       -ogcopt float
           Internal oligo optimum GC percent. Default value: 50.0

       -ogcmin float
           Minimum allowable percentage of Gs and Cs in an internal oligo. Default value: 20.0

       -ogcmax float
           Maximum allowable percentage of Gs and Cs in any internal oligo generated by Primer.
           Default value: 80.0

       -osaltconc float
           The millimolar concentration of salt (usually KCl) in the hybridization. EPrimer3 uses
           this argument to calculate internal oligo melting temperatures. Default value: 50.0

       -odnaconc float
           The nanomolar concentration of annealing internal oligo in the hybridization. Default
           value: 50.0

       -oanyself float
           The maximum allowable local alignment score when testing an internal oligo for (local)
           self-complementarity. Local self-complementarity is taken to predict the tendency of
           oligos to anneal to themselves The scoring system gives 1.00 for complementary bases,
           -0.25 for a match of any base (or N) with an N, -1.00 for a mismatch, and -2.00 for a
           gap. Only single-base-pair gaps are allowed. For example, the alignment 5' ATCGNA 3'
           || | | 3' TA-CGT 5' is allowed (and yields a score of 1.75), but the alignment 5'
           ATCCGNA 3' || | | 3' TA--CGT 5' is not considered. Scores are non-negative, and a
           score of 0.00 indicates that there is no reasonable local alignment between two
           oligos. Default value: 12.00

       -oendself float
           The maximum allowable 3'-anchored global alignment score when testing a single oligo
           for self-complementarity. The scoring system is as for the Maximum Complementarity
           argument. In the examples above the scores are 7.00 and 6.00 respectively. Scores are
           non-negative, and a score of 0.00 indicates that there is no reasonable 3'-anchored
           global alignment between two oligos. In order to estimate 3'-anchored global
           alignments for candidate oligos, Primer assumes that the sequence from which to choose
           oligos is presented 5' to 3'. INTERNAL-OLIGO-SELF-END is meaningless when applied to
           internal oligos used for hybridization-based detection, since primer-dimer will not
           occur. We recommend that INTERNAL-OLIGO-SELF-END be set at least as high as
           INTERNAL-OLIGO-SELF-ANY. Default value: 12.00

       -opolyxmax integer
           The maximum allowable length of an internal oligo mononucleotide repeat, for example
           AAAAAA. Default value: 5

       -omishybmax float
           Similar to MAX-MISPRIMING except that this parameter applies to the similarity of
           candidate internal oligos to the library specified in INTERNAL-OLIGO-MISHYB-LIBRARY.
           Default value: 12.0

   Advanced section
       -explainflag boolean
           If this flag is true, produce LEFT-EXPLAIN, RIGHT-EXPLAIN, and INTERNAL-OLIGO-EXPLAIN
           output tags, which are intended to provide information on the number of oligos and
           primer pairs that EPrimer3 examined, and statistics on the number discarded for
           various reasons. Default value: N

       -fileflag boolean
           If the associated value is true, then EPrimer3 creates two output files for each input
           SEQUENCE. File (sequence-id).for lists all acceptable forward primers for
           (sequence-id), and (sequence-id).rev lists all acceptable reverse primers for
           (sequence-id), where (sequence-id) is the value of the SEQUENCE-ID tag (which must be
           supplied). In addition, if the input tag TASK is 1 or 4, EPrimer3 produces a file
           (sequence-id).int, which lists all acceptable internal oligos. Default value: N

       -firstbaseindex integer
           This parameter is the index of the first base in the input sequence. For input and
           output using 1-based indexing (such as that used in GenBank and to which many users
           are accustomed) set this parameter to 1. For input and output using 0-based indexing
           set this parameter to 0. (This parameter also affects the indexes in the contents of
           the files produced when the primer file flag is set.) Default value: 1

       -pickanyway boolean
           If true pick a primer pair even if LEFT-INPUT, RIGHT-INPUT, or INTERNAL-OLIGO-INPUT
           violates specific constraints. Default value: N

       -maxmispriming float
           The maximum allowed weighted similarity with any sequence in MISPRIMING-LIBRARY.
           Default value: 12.00

       -pairmaxmispriming float
           The maximum allowed sum of weighted similarities of a primer pair (one similarity for
           each primer) with any single sequence in MISPRIMING-LIBRARY. Default value: 24.00

       -numnsaccepted integer
           Maximum number of unknown bases (N) allowable in any primer.

       -selfany float
           The maximum allowable local alignment score when testing a single primer for (local)
           self-complementarity and the maximum allowable local alignment score when testing for
           complementarity between forward and reverse primers. Local self-complementarity is
           taken to predict the tendency of primers to anneal to each other without necessarily
           causing self-priming in the PCR. The scoring system gives 1.00 for complementary
           bases, -0.25 for a match of any base (or N) with an N, -1.00 for a mismatch, and -2.00
           for a gap. Only single-base-pair gaps are allowed. For example, the alignment 5'
           ATCGNA 3' ...|| | | 3' TA-CGT 5' is allowed (and yields a score of 1.75), but the
           alignment 5' ATCCGNA 3' ...|| | | 3' TA--CGT 5' is not considered. Scores are
           non-negative, and a score of 0.00 indicates that there is no reasonable local
           alignment between two oligos. Default value: 8.00

       -selfend float
           The maximum allowable 3'-anchored global alignment score when testing a single primer
           for self-complementarity, and the maximum allowable 3'-anchored global alignment score
           when testing for complementarity between forward and reverse primers. The 3'-anchored
           global alignment score is taken to predict the likelihood of PCR-priming
           primer-dimers, for example 5' ATGCCCTAGCTTCCGGATG 3' .............||| |||||
           ..........3' AAGTCCTACATTTAGCCTAGT 5' or 5' AGGCTATGGGCCTCGCGA 3'
           ...............|||||| ............3' AGCGCTCCGGGTATCGGA 5' The scoring system is as
           for the Maximum Complementarity argument. In the examples above the scores are 7.00
           and 6.00 respectively. Scores are non-negative, and a score of 0.00 indicates that
           there is no reasonable 3'-anchored global alignment between two oligos. In order to
           estimate 3'-anchored global alignments for candidate primers and primer pairs, Primer
           assumes that the sequence from which to choose primers is presented 5' to 3'. It is
           nonsensical to provide a larger value for this parameter than for the Maximum (local)
           Complementarity parameter because the score of a local alignment will always be at
           least as great as the score of a global alignment. Default value: 3.00

   Primer penalty weights
       -maxendstability float
           The maximum stability for the five 3' bases of a forward or reverse primer. Bigger
           numbers mean more stable 3' ends. The value is the maximum delta G for duplex
           disruption for the five 3' bases as calculated using the nearest neighbor parameters
           published in Breslauer, Frank, Bloecker and Marky, Proc. Natl. Acad. Sci. USA, vol 83,
           pp 3746-3750. EPrimer3 uses a completely permissive default value for backward
           compatibility (which we may change in the next release). Rychlik recommends a maximum
           value of 9 (Wojciech Rychlik, 'Selection of Primers for Polymerase Chain Reaction' in
           BA White, Ed., 'Methods in Molecular Biology, Vol. 15: PCR Protocols: Current Methods
           and Applications', 1993, pp 31-40, Humana Press, Totowa NJ). Default value: 9.0

   Output section
       -outfile outfile

BUGS

       Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or
       directly to the EMBOSS developers
       (http://sourceforge.net/tracker/?group_id=93650&atid=605031).

SEE ALSO

       eprimer3 is fully documented via the tfm(1) system.

AUTHOR

       Debian Med Packaging Team <debian-med-packaging@lists.alioth.debian.org>
           Wrote the script used to autogenerate this manual page.

COPYRIGHT

       This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package.
       It can be redistributed under the same terms as EMBOSS itself.