Provided by: libbio-perl-perl_1.7.2-3_all bug

NAME

       Bio::Seq::PrimedSeq - A sequence and a pair of primers matching on it

SYNOPSIS

         use Bio::Seq;
         use Bio::Seq::PrimedSeq;

         my $template = Bio::Seq->new( -seq => 'AGCTTTTCATTCTGACTGCAAC' );
         my $left     = Bio::Seq->new( -seq => 'AGCT' );
         my $right    = Bio::Seq->new( -seq => 'GTTGC' );

         my $primedseq = Bio::Seq::PrimedSeq->new(
                 -seq          => $template,  # sequence object
                 -left_primer  => $left,      # sequence or primer object
                 -right_primer => $right      # sequence or primer object
         );

         # Get the primers as Bio::SeqFeature::Primer objects
         my @primer_objects = $primedseq->get_primer();

         # Sequence object representing the PCR product, i.e. the section of the target
         # sequence contained between the primers (primers included)
         my $amplicon_seq = $primedseq->amplicon();

         print 'Got amplicon sequence: '.$amplicon_seq->seq."\n";
         # Amplicon should be: agctTTTCATTCTGACTgcaac

DESCRIPTION

       This module was created to address the fact that a primer is more than a SeqFeature and
       that there is a need to represent the primer-sequence complex and the attributes that are
       associated with the complex.

       A PrimedSeq object is initialized with a target sequence and two primers. The location of
       the primers on the target sequence is calculated if needed so that one can then get the
       PCR product, or amplicon sequence. From the PrimedSeq object you can also retrieve
       information about melting temperatures and what not on each of the primers and the
       amplicon. The Bio::Tools::Primer3 module uses PrimedSeq objects extensively.

       Note that this module does not simulate PCR. It assumes that the primers will match in a
       single location on the target sequence and does not understand degenerate primers.

       ·   Providing primers as sequence objects

           If the primers are specified as sequence objects, e.g. Bio::PrimarySeq or Bio::Seq,
           they are first converted to Bio::SeqFeature::Primer objects.  Their location on the
           target sequence is then calculated and added to the Bio::SeqFeature::Primer objects,
           which you can retrieve using the get_primer() method.

       ·   Providing primers as primer objects

           Because of the limitations of specifying primers as sequence objects, the recommended
           method is to provide Bio::SeqFeature::Primer objects. If you did not record the
           location of the primers in the primer object, it will be calculated.

       Bio::Seq::PrimedSeq was initially started by Chad Matsalla, and later improved on by Rob
       Edwards.

RECIPES

       1.  Run Primer3 to get PrimedSeq objects:

             use Bio::SeqIO;
             use Bio::Tools::Run::Primer3;

             # Read a target sequences from a FASTA file
             my $file = shift || die "Need a file to read";
             my $seqin = Bio::SeqIO->new(-file => $file);
             my $seq = $seqin->next_seq;

             # Use Primer3 to design some primers
             my $primer3 = Bio::Tools::Run::Primer3->new(-seq => $seq);
             my $results = $primer3->run; # default parameters

             # Write all the results in a Genbank file
             my $seqout = Bio::SeqIO->new(-file => ">primed_sequence.gbk",
                                          -format => 'genbank');
             while (my $primedseq = $results->next_primer) {
                $seqout->write_seq( $primedseq->annotated_seq );
             }

       2.  Create a genbank file for a sequence and its cognate primers:

             use Bio::SeqIO;
             use Bio::Seq::PrimedSeq;

             # Read a FASTA file that contains the target sequence and its two primers
             my $file = shift || die "$0 <file>";
             my $seqin = Bio::SeqIO->new(-file => $file);
             my ($template, $leftprimer, $rightprimer) =
                   ($seqin->next_seq, $seqin->next_seq, $seqin->next_seq);

             # Set up a PrimedSeq object
             my $primedseq = Bio::Seq::PrimedSeq->new(-seq => $template,
                                                      -left_primer => $leftprimer,
                                                      -right_primer => $rightprimer);

             # Write the sequences in an output Genbank file
             my $seqout = Bio::SeqIO->new(-file => ">primed_sequence.gbk",
                                          -format => 'genbank');
             $seqout->write_seq($primedseq->annotated_sequence);

FEEDBACK

       User feedback is an integral part of the evolution of this and other Bioperl modules. Send
       your comments and suggestions preferably to one of the Bioperl mailing lists.  Your
       participation is much appreciated.

         bioperl-l@bioperl.org                  - General discussion
         http://bioperl.org/wiki/Mailing_lists  - About the mailing lists

   Support
       Please direct usage questions or support issues to the mailing list:

       bioperl-l@bioperl.org

       rather than to the module maintainer directly. Many experienced and reponsive experts will
       be able look at the problem and quickly address it. Please include a thorough description
       of the problem with code and data examples if at all possible.

   Reporting Bugs
       Report bugs to the Bioperl bug tracking system to help us keep track the bugs and their
       resolution.  Bug reports can be submitted via the web:

         https://github.com/bioperl/bioperl-live/issues

AUTHOR

       Rob Edwards, redwards@utmem.edu

       Based on a module written by Chad Matsalla, bioinformatics1@dieselwurks.com

APPENDIX

       The rest of the documentation details each of the object methods. Internal methods are
       usually preceded with a _

   new
        Title   : new()
        Usage   : my $primedseq = Bio::SeqFeature::Primer->new(
                                   -seq => $sequence,
                                   -left_primer => $left_primer,
                                   -right_primer => $right_primer
                  );
        Function: Construct a primed sequence.
        Returns : A Bio::Seq::PrimedSeq object
        Args    :  -seq => a Bio::Seq object (required)
                   -left_primer => a Bio::SeqFeature::Primer or sequence object (required)
                   -right_primer => a Bio::SeqFeature::Primer or sequence object (required)

                  If you pass a sequence object to specify a primer, it will be used to
                  construct a Bio::SeqFeature::Primer that you can retrieve with the
                  L<get_primer> method.

                  Many other parameters can be included including all of the output
                  parameters from the primer3 program (see L<Bio::Tools::Primer3>). At
                  the moment these parameters will simply be stored and do anything.

   get_primer
        Title   : get_primer();
        Usage   :  my @primers = $primedseq->get_primer();
                     or
                   my $primer = $primedseq->get_primer('-left_primer');
        Function: Get the primers associated with the PrimedSeq object.
        Returns : A Bio::SeqFeature::Primer object
        Args    : For the left primer, use: l, left, left_primer or -left_primer
                  For the right primer, use: r, right, right_primer or -right_primer
                  For both primers [default], use: b, both, both_primers or -both_primers

   annotated_sequence
        Title   : annotated_sequence
        Usage   : my $annotated_sequence_object = $primedseq->annotate_sequence();
        Function: Get an annotated sequence object containing the left and right
                  primers
        Returns : An annotated sequence object or 0 if not defined.
        Args    :
        Note    : Use this method to return a sequence object that you can write
                  out (e.g. in GenBank format). See the example above.

   amplicon
        Title   : amplicon
        Usage   : my $amplicon = $primedseq->amplicon();
        Function: Retrieve the amplicon as a sequence object. The amplicon sequnce is
                  only the section of the target sequence between the primer matches
                  (primers included).
        Returns : A Bio::Seq object. To get the sequence use $amplicon->seq
        Args    : None
        Note    :

   seq
        Title   : seq
        Usage   : my $seqobj = $primedseq->seq();
        Function: Retrieve the target sequence as a sequence object
        Returns : A seq object. To get the sequence use $seqobj->seq
        Args    : None
        Note    :

   _place_primers
        Title   : _place_primers
        Usage   : $self->_place_primers();
        Function: An internal method to place the primers on the sequence and
                  set up the ranges of the sequences
        Returns : Nothing
        Args    : None
        Note    : Internal use only