Provided by: libhts-dev_1.9-10_amd64 bug

NAME

       faidx - an index enabling random access to FASTA and FASTQ files

SYNOPSIS

       file.fa.fai, file.fasta.fai, file.fq.fai, file.fastq.fai

DESCRIPTION

       Using  an  fai  index  file  in  conjunction  with a FASTA/FASTQ file containing reference
       sequences enables efficient access to arbitrary regions within those reference  sequences.
       The index file typically has the same filename as the corresponding FASTA/FASTQ file, with
       .fai appended.

       An fai index file is a text file consisting of lines each with five TAB-delimited  columns
       for a FASTA file and six for FASTQ:

       NAME         Name of this reference sequence
       LENGTH       Total length of this reference sequence, in bases
       OFFSET       Offset in the FASTA/FASTQ file of this sequence's first base
       LINEBASES    The number of bases on each line
       LINEWIDTH    The number of bytes in each line, including the newline
       QUALOFFSET   Offset of sequence's first quality within the FASTQ file

       The  NAME and LENGTH columns contain the same data as would appear in the SN and LN fields
       of a SAM @SQ header for the same reference sequence.

       The OFFSET column contains the offset within the FASTA/FASTQ file, in bytes starting  from
       zero,  of  the first base of this reference sequence, i.e., of the character following the
       newline at the end of the header line (the ">" line in FASTA, "@" in FASTQ). Typically the
       lines  of  a fai index file appear in the order in which the reference sequences appear in
       the FASTA/FASTQ file, so .fai files are typically sorted according to this column.

       The LINEBASES column contains the number of bases in each of the sequence lines that  form
       the  body of this reference sequence, apart from the final line which may be shorter.  The
       LINEWIDTH column contains the number of bytes  in  each  of  the  sequence  lines  (except
       perhaps  the  final  line), thus differing from LINEBASES in that it also counts the bytes
       forming the line terminator.

       The QUALOFFSET works the same way as OFFSET but  for  the  first  quality  score  of  this
       reference sequence.  This would be the first character following the newline at the end of
       the "+" line.  For FASTQ files only.

   FASTA Files
       In order to be indexed with samtools faidx, a FASTA file must be a text file of the form

              >name [description...]
              ATGCATGCATGCATGCATGCATGCATGCAT
              GCATGCATGCATGCATGCATGCATGCATGC
              ATGCAT
              >name [description...]
              ATGCATGCATGCAT
              GCATGCATGCATGC
              [...]

       In particular, each reference sequence must be "well-formatted", i.e., all of its sequence
       lines  must  be  the same length, apart from the final sequence line which may be shorter.
       (While this sequence line length must be the  same  within  each  sequence,  it  may  vary
       between different reference sequences in the same FASTA file.)

       This also means that although the FASTA file may have Unix- or Windows-style or other line
       termination, the newline characters present must  be  consistent,  at  least  within  each
       reference sequence.

       The  samtools  implementation uses the first word of the ">" header line text (i.e., up to
       the first whitespace character, having skipped any initial whitespace after  the  ">")  as
       the NAME column.

   FASTQ Files
       FASTQ files for indexing work in the same way as the FASTA files.

              @name [description...]
              ATGCATGCATGCATGCATGCATGCATGCAT
              GCATGCATGCATGCATGCATGCATGCATGC
              ATGCAT
              +
              FFFA@@FFFFFFFFFFHHB:::@BFFFFGG
              HIHIIIIIIIIIIIIIIIIIIIIIIIFFFF
              8011<<
              @name [description...]
              ATGCATGCATGCAT
              GCATGCATGCATGC
              +
              IIA94445EEII==
              =>IIIIIIIIICCC
              [...]

       Quality lines must be wrapped at the same length as the corresponding sequence lines.

EXAMPLE

       For example, given this FASTA file

              >one
              ATGCATGCATGCATGCATGCATGCATGCAT
              GCATGCATGCATGCATGCATGCATGCATGC
              ATGCAT
              >two another chromosome
              ATGCATGCATGCAT
              GCATGCATGCATGC

       formatted with Unix-style (LF) line termination, the corresponding fai index would be

              one   66    5   30   31
              two   28   98   14   15

       If  the  FASTA  file  were  formatted with Windows-style (CR-LF) line termination, the fai
       index would be

              one   66     6   30   32
              two   28   103   14   16

       An example FASTQ file

              @fastq1
              ATGCATGCATGCATGCATGCATGCATGCAT
              GCATGCATGCATGCATGCATGCATGCATGC
              ATGCAT
              +
              FFFA@@FFFFFFFFFFHHB:::@BFFFFGG
              HIHIIIIIIIIIIIIIIIIIIIIIIIFFFF
              8011<<
              @fastq2
              ATGCATGCATGCAT
              GCATGCATGCATGC
              +
              IIA94445EEII==
              =>IIIIIIIIICCC

       Formatted with Unix-style line termination would give this fai index

              fastq1   66     8   30   31    79
              fastq2   28   156   14   15   188

SEE ALSO

       samtools(1)

       https://en.wikipedia.org/wiki/FASTA_format

       https://en.wikipedia.org/wiki/FASTQ_format

              Further description of the FASTA and FASTQ formats