Provided by: libvcflib-tools_1.0.9+dfsg1-2_amd64 bug

NAME

       vcfcreatemulti  -  collates  single  ALT  allele  records  into multi-allele records while
       tracking genotypes

SYNOPSIS

       vcfcreatemulti

DESCRIPTION

       vcfcreatemulti merges VCF records into one line by combining ALT alleles into a single VCF
       record.  This tool is a great companion to vcfwave.

       In  2022 vcfcreatemulti has been upgraded to track INFO records and genotypes (samples) so
       they are updated in the output.

       Note that the tool is not perfect: See below EXAMPLES, the caveat on `too  many  variants'
       MULTI=ALTPROBLEM, and vcfwave for more information.

   Options
       -h, –help
              shows help message and exits.

       See more below.

EXIT VALUES

       0      Success

       not 0  Failure

EXAMPLES

              >>> head("vcfcreatemulti -h",25)
              >
              Usage: vcfcreatemulti [options] [file]
              >
              Go through sorted VCF and when overlapping alleles are represented across multiple records, merge them into a single multi-ALT record. See the documentation for more information.
              >
              options:
              >
                  --quiet           no progress bar
                  --legacy          legacy mode (old C++ implementation does not do genotypes)
              >
              Type: transformation
              >

       The  original `legacy' vcfcreatemulti can combine overlapping alleles onto one record (VCF
       line), but it does not correct the INFO fields and sample (genotypes).  For example:

              >>> sh("cat ../samples/10158243-after-vcfwave.vcf|grep -v ^\#")
              grch38#chr4     10158244        >3655>3662_1    CCCCCACCCCCAC   C       60      .       AC=1;AF=0.011236;AN=89;AT=>3655>3656>3657>3660>3662;NS=45;LV=0;ORIGIN=grch38#chr4:10158243;LEN=12;INV=0;TYPE=del        GT      0|0     0|0     0|0     0|0     1|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0
              grch38#chr4     10158244        >3655>3662_2    CCCCCACCCCCACC  C       60      .       AC=3;AF=0.033708;AN=89;AT=>3655>3656>3660>3662;NS=45;LV=0;ORIGIN=grch38#chr4:10158243;LEN=13;INV=0;TYPE=del     GT      0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     1|0     0|1     0|0     0|0     0|0     0|0     0|0     0|0     0|1     0|0     0
              grch38#chr4     10158245        >3655>3662_3    CCCCACCCCCACC   C       60      .       AC=64;AF=0.719101;AN=89;AT=>3655>3656>3657>3658>3659>3660>3662;NS=45;LV=0;ORIGIN=grch38#chr4:10158243;LEN=12;INV=0;TYPE=del     GT      0|0     1|1     1|1     1|0     0|1     0|0     0|1     0|1     1|1     1|1     1|1     1|1     1|1     1|1     1|1     0|0     1|1     1|1     1|1     1|0     1|0     1|0     1|0     1|1     1|1     1|0     1|1     1|1     0|0     1|0     1|1     0|1     1|1     1|1     0|1     1|0     1|1     1|1     0|1     1|1     1|1     1|0     1|0     1|1     0
              grch38#chr4     10158251        >3655>3662_4    CCCCACC C       60      .       AC=3;AF=0.033708;AN=89;AT=>3655>3656>3657>3658>3660>3662;NS=45;LV=0;ORIGIN=grch38#chr4:10158243;LEN=6;INV=0;TYPE=del    GT      0|0     0|0     0|0     0|0     0|0     0|1     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     1|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|1     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0
              grch38#chr4     10158256        >3655>3662_5    CC      C       60      .       AC=2;AF=0.022472;AN=89;AT=>3655>3660>3662;NS=45;LV=0;ORIGIN=grch38#chr4:10158243;LEN=1;INV=0;TYPE=del   GT      0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|1     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     1|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0
              grch38#chr4     10158257        >3655>3662_6    C       A       60      .       AC=1;AF=0.011236;AN=89;AT=>3655>3656>3657>3660>3662;NS=45;LV=0;ORIGIN=grch38#chr4:10158243;LEN=1;INV=0;TYPE=snp GT      0|0     .|.     .|.     .|.     .|.     .|.     .|.     .|.     .|.     .|.     .|.     .|.     .|.     .|.     .|.     .|.     .|.     .|.     .|.     .|.     .|.     .|.     .|.     .|.     .|.     .|.     .|.     .|.     .|.     .|.     .|.     .|.     .|.     .|.     .|.     .|.     .|.     .|.     .|.     .|.     .|.     .|.     .|.     .|.     0

       this now gets converted into the following:

              >>> sh("../build/vcfcreatemulti ../samples/10158243-after-vcfwave.vcf|grep -v ^\#")
              grch38#chr4     10158244        >3655>3662_1    CCCCCACCCCCACC  CC,C,CC,CCCCCACC,CCCCCACCCCCAC,CCCCCACCCCCACA   60      .       AC=1,3,64,3,2,1;AF=0.011236,0.033708,0.719101,0.033708,0.022472,0.011236;AN=89,89,89,89,89,89;AT=>3655>3656>3657>3660>3662,>3655>3656>3660>3662,>3655>3656>3657>3658>3659>3660>3662,>3655>3656>3657>3658>3660>3662,>3655>3660>3662,>3655>3656>3657>3660>3662;NS=45;LV=0;ORIGIN=grch38#chr4:10158243;LEN=12;INV=0,0,0,0,0,0;TYPE=del,del,del,del,del,snp;combined=10158244-10158257      GT      0|0     3|3     3|3     3|0     1|3     0|4     0|3     0|3     3|3     3|3     3|3     3|3     3|3     3|3     3|3     4|5     3|3     3|3     3|3     3|0     3|0     3|0     3|0     3|3     3|3     3|4     3|3     3|3     5|0     3|0     3|3     0|3     3|3     3|3     2|3     3|2     3|3     3|3     0|3     3|3     3|3     3|0     3|2     3|3     0

   Too many variants
       Or the MULTI=ALTPROBLEM.

       That looks proper.  There is one  caveat  or  blatant  problem,  however.   If  a  variant
       sequence  is  long  (a  large `bubble') and with the other alleles more (small) INDELs are
       scored than there are samples then the genotypes represent only the last match.  Resulting
       in something ugly:

              ...,del,del,snp,ins,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,s np,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,s np,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp;combined=36390210-36409660 GT

              509|49 8 500|500 20|251  500|238 238|498 653|387 102|1 500|498 9|509 498|69  500|297 498|725 498|660 500|472 204|500 50 0|846 654|653 500|500 500|500 18|18 430|498 214|500 499|299 67|500  18|386  47|154  508|47  500|385 42|47 579|47 47|18 47|47 219|500 18|47 53|213  500|18  500|18  500|500 47|846  47|47 500|47  500|47  839|500 498|47  500

       this  is  a  simple  artefact  resulting  from the fact that complex structures do not map
       (easily) on the simple VCF layout.  Another  problem  is  that  multiple  SNPs  don’t  get
       incorporated  in  the  ALTs - the algorithm uses the reference to build up the longer ALTs
       for every single SNP from the start.

       In this example you see that the ALT for SNP2 does not contain SNP1 even though  they  may
       be in the same individual/sample:

                                     sample
              REF      ACTGACTGACTG
              ALT-SNP1 ACTGC          1/0
              ALT-SNP2 ACTGACTA       1/0
                           ^

       In words: the result is incorrect.

       At  this  point,  for  analysis,  there  is  little else to do but go to the original data
       (pangenome or VCF) and compare the results.  What vcfcreatemulti helps to do is point  out
       that  there  is  a  complex region here with ample variation and the resulting layout is a
       problem (too many ALTs as in `too many cooks'!).

       To help vcflib show’s a `WARNING: Too many ALT alleles to fit in sample(s)’ and we add  an
       INFO tag “MULTI=ALTPROBLEM”.  Searching for these will give an idea of this issue.  E.g.

              grep MULTI= ./test/tmp/vcfcreatemulti_2.vcf -c

       Finds 3 marked records.  One of them is derived from the combination:

              grch38#chr8 36377478  >601>606  GTTTCTTGAAAAACCAAATGT GTTTCTTGAAAAACCAAAGGT,G 60  . AC=20,1;AF=0.224719,0.011236
              ;AN=89;AT=>601>602>603>605>606,>601>602>604>605>606,>601>606;NS=45;LV=0 GT  0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0
              0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 1|1 0|0 0|0 0|0 0|0 1|0 1|0 0|2 0|0 0|1 0|1 1|1 1|1 0|0 1|1 0|0 0|1 0|1
              0|0 1|0 1|1 0|1 0|1 0|0 0|1 0
              grch38#chr8 36377496  >602>605  T G 60  . AC=20;AF=0.227273;AN=88;AT=>602>603>605,>602>604>605;NS=45;LV=1;PS=>60
              1>606 GT  0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 1|1 0|0 0|0 0|0 0|0 1|0 1|
              0 0|. 0|0 0|1 0|1 1|1 1|1 0|0 1|1 0|0 0|1 0|1 0|0 1|0 1|1 0|1 0|1 0|0 0|1 0

       resulting in

              grch38#chr8 36377478  >601>606  GTTTCTTGAAAAACCAAATGT GTTTCTTGAAAAACCAAAGGT,G,GTTTCTTGAAAAACCAAAGGT 60  . AC=20,
              1,20;AF=0.224719,0.011236,0.227273;AN=89,89,88;AT=>601>602>603>605>606,>601>602>604>605>606,>601>602>603>605>606
              ,>601>606,>602>603>605,>602>604>605;NS=45;LV=0;MULTI=ALTPROBLEM;combined=36377478-36377496  GT  0|0 0|0 0|0 0|0
              0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 3|3 0|0 0|0 0|0 0|0 3|0 3|0 0|2 0|0 0|3 0|3 3|3 3|3
              0|0 3|3 0|0 0|3 0|3 0|0 3|0 3|3 0|3 0|3 0|0 0|3 0

       This is a combination of:

              grch38#chr8 36377478  >601>606  GTTTCTTGAAAAACCAAATGT GTTTCTTGAAAAACCAAAGGT,G 60  . AC=20,1;AF=0.224719,0.011236
              ;AN=89;AT=>601>602>603>605>606,>601>602>604>605>606,>601>606;NS=45;LV=0 GT  0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0
              0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 1|1 0|0 0|0 0|0 0|0 1|0 1|0 0|2 0|0 0|1 0|1 1|1 1|1 0|0 1|1 0|0 0|1 0|1
              0|0 1|0 1|1 0|1 0|1 0|0 0|1 0
              grch38#chr8 36377496  >602>605  T G 60  . AC=20;AF=0.227273;AN=88;AT=>602>603>605,>602>604>605;NS=45;LV=1;PS=>60
              1>606 GT  0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 1|1 0|0 0|0 0|0 0|0 1|0 1|
              0 0|. 0|0 0|1 0|1 1|1 1|1 0|0 1|1 0|0 0|1 0|1 0|0 1|0 1|1 0|1 0|1 0|0 0|1 0

       Where  the  ALTs  end  up  being  a  duplication and there is some overlap in the genotype
       calling.

       One future solution might be to have vcfcreatemulti ignore SNPs, or only  take  the  first
       one,  but  that  somewhat  would  do away with pointing out complex arrangements.  Another
       solution might be to edit the ALTs and merge ALT-SNP1 into ALT-SNP2 so  we  get  ACTGCCTA.
       Contributions and ideas are welcome!

       Having  a think about this: the safest approach is to backtrack on a conflict and leave it
       alone.  So, when a variant comes up that conflicts with the combined record  (so  far)  we
       should  drop  merging  that variant and leave it alone.  This will typically happen with a
       long ALT that overlaps many SNPs.  We could come up with all types of solutions,  but  the
       point of this algorithm is to `fix' the obvious cases.  At this point we continue and show
       the MULTI=ALTPROBLEM info field.  It is not satisfactory and it is slow too.  We can  have
       a stab at the backtrack in the future.

./vcfcreatemulti ../samples/grch38#chr8_36353854-36453166.vcf >

       ../test/data/regression/vcfcreatemulti_2.vcf
                            run_stdout(“vcfcreatemulti
                            ../samples/grch38#chr8_36353854-36453166-bcftools-normalised.vcf”,
                            ext=“vcf”, uniq=2) output in vcfcreatemulti_2.vcf

                            run_stdout(“vcfcreatemulti ../samples/sample.vcf”, ext=“vcf”, uniq=3)
                            output in vcfcreatemulti_3.vcf

              Check if the legacy version is still the same. Note it only retains the first genotype and has duplicate 'CC' alt alleles. INFO fields are not correct either.

              ```python
              >>> sh("../build/vcfcreatemulti --legacy ../samples/10158243-after-vcfwave.vcf|grep -v ^\#")
              grch38#chr4     10158244        >3655>3662_1    CCCCCACCCCCACC  CC,C,CC,CCCCCACC,CCCCCACCCCCAC,CCCCCACCCCCACA   60      .       AC=1;AF=0.011236;AN=89;AT=>3655>3656>3657>3660>3662;NS=45;LV=0;ORIGIN=grch38#chr4:10158243;LEN=12;INV=0;TYPE=del;combined=10158244-10158257     GT      0|0     0|0     0|0     0|0     1|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0|0     0

   Trouble shooting
       If you get an error like

              thread 502 panic: attempt to unwrap error: MultiAltNotSupported

       It means the input file already contains multi-allele VCF records.  To split these you can
       run a command such as bcftools norm -m-  to  normalise  the  VCF  records  and  split  out
       multiple  ALT  alleles  into  separate  VCF records.  Finally use vcfcreatemulti to create
       multi-allele VCF records again.

   Warning: Too many ALT alleles to fit in sample(s)
       See `caveat' section above.

   Warning: This code only supports one ALT allele per record: bailing out  try normalising  the
       data with bcftools norm -m-
       Your  VCF  already  contains  multi-allele entries - bring them back to one single ALT per
       record/line.

LICENSE

       Copyright 2022-2023 (C) Erik Garrison, Pjotr Prins and vcflib contributors.  MIT licensed.

AUTHORS

       Erik Garrison, Pjotr Prins and other vcflib contributors.