Provided by: libbio-perl-perl_1.6.901-2_all bug


       Bio::Perl - Functional access to BioPerl for people who don't know objects


         use Bio::Perl;

         # will guess file format from extension
         $seq_object = read_sequence($filename);

         # forces genbank format
         $seq_object = read_sequence($filename,'genbank');

         # reads an array of sequences
         @seq_object_array = read_all_sequences($filename,'fasta');

         # sequences are Bio::Seq objects, so the following methods work
         # for more info see Bio::Seq, or do 'perldoc Bio/'

         print "Sequence name is ",$seq_object->display_id,"\n";
         print "Sequence acc  is ",$seq_object->accession_number,"\n";
         print "First 5 bases is ",$seq_object->subseq(1,5),"\n";

         # get the whole sequence as a single string

         $sequence_as_a_string = $seq_object->seq();

         # writing sequences



         # making a new sequence from just a string

         $seq_object = new_sequence("ATTGGTTTGGGGACCCAATTTGTGTGTTATATGTA",

         # getting a sequence from a database (assumes internet connection)

         $seq_object = get_sequence('swissprot',"ROA1_HUMAN");

         $seq_object = get_sequence('embl',"AI129902");

         $seq_object = get_sequence('genbank',"AI129902");

         # BLAST a sequence (assummes an internet connection)

         $blast_report = blast_sequence($seq_object);



       Easy first time access to BioPerl via functions.


   Mailing Lists
       User feedback is an integral part of the evolution of this and other Bioperl modules. Send
       your comments and suggestions preferably to one of the Bioperl mailing lists.  Your
       participation is much appreciated.

       Please direct usage questions or support issues to the mailing list:

       rather than to the module maintainer directly. Many experienced and reponsive experts will
       be able look at the problem and quickly address it. Please include a thorough description
       of the problem with code and data examples if at all possible.

   Reporting Bugs
       Report bugs to the Bioperl bug tracking system to help us keep track the bugs and their
       resolution. Bug reports can be submitted via the web:

AUTHOR - Ewan Birney



       The rest of the documentation details each of the object methods.  Internal methods are
       usually preceded with a _

        Title   : read_sequence
        Usage   : $seq = read_sequence('sequences.fa')
                  $seq = read_sequence($filename,'genbank');

                  # pipes are fine
                  $seq = read_sequence("my_fetching_program $id |",'fasta');

        Function: Reads the top sequence from the file. If no format is given, it will
                  try to guess the format from the filename. If a format is given, it
                  forces that format. The filename can be any valid perl open() string
                  - in particular, you can put in pipes

        Returns : A Bio::Seq object. A quick synopsis:
                  $seq_object->display_id - name of the sequence
                  $seq_object->seq        - sequence as a string

        Args    : Two strings, first the filename - any Perl open() string is ok
                  Second string is the format, which is optional

       For more information on Seq objects see Bio::Seq.

        Title   : read_all_sequences
        Usage   : @seq_object_array = read_all_sequences($filename);
                  @seq_object_array = read_all_sequences($filename,'genbank');

        Function: Just as the function above, but reads all the sequences in the
                  file and loads them into an array.

                  For very large files, you will run out of memory. When this
                  happens, you've got to use the SeqIO system directly (this is
                  not so hard! Don't worry about it!).

        Returns : array of Bio::Seq objects

        Args    : two strings, first the filename (any open() string is ok)
                  second the format (which is optional)

       See Bio::SeqIO and Bio::Seq for more information

        Title   : write_sequence
        Usage   : write_sequence(">",'genbank',$seq)

        Function: writes sequences in the specified format

        Returns : true

        Args    : filename as a string, must provide an open() output file
                  format as a string
                  one or more sequence objects

        Title   : new_sequence
        Usage   : $seq_obj = new_sequence("GATTACA", "kino-enzyme");

        Function: Construct a sequency object from sequence string
        Returns : A Bio::Seq object

        Args    : sequence string
                  name string (optional, default "no-name-for-sequence")
                  accession - accession number (optional, no default)

        Title   : blast_sequence
        Usage   : $blast_result = blast_sequence($seq)
                  $blast_result = blast_sequence('MFVEGGTFASEDDDSASAEDE');

        Function: If the computer has Internet accessibility, blasts
                  the sequence using the NCBI BLAST server against nrdb.

                  It chooses the flavour of BLAST on the basis of the sequence.

                  This function uses Bio::Tools::Run::RemoteBlast, which itself
                  use Bio::SearchIO - as soon as you want to know more, check out
                  these modules
        Returns :

        Args    : Either a string of protein letters or nucleotides, or a
                  Bio::Seq object

        Title   : write_blast
        Usage   : write_blast($filename,$blast_report);

        Function: Writes a BLAST result object (or more formally
                  a SearchIO result object) out to a filename
                  in BLAST-like format

        Returns : none

        Args    : filename as a string
                  Bio::SearchIO::Results object

        Title   : get_sequence
        Usage   : $seq_object = get_sequence('swiss',"ROA1_HUMAN");

        Function: If the computer has Internet access this method gets
                  the sequence from Internet accessible databases. Currently
                  this supports Swissprot ('swiss'), EMBL ('embl'), GenBank
                  ('genbank'), GenPept ('genpept'), and RefSeq ('refseq').

                  Swissprot and EMBL are more robust than GenBank fetching.

                  If the user is trying to retrieve a RefSeq entry from
                  GenBank/EMBL, the query is silently redirected.

        Returns : A Bio::Seq object

        Args    : database type - one of swiss, embl, genbank, genpept, or

        Title   : translate
        Usage   : $seqobj = translate($seq_or_string_scalar)

        Function: translates a DNA sequence object OR just a plain
                  string of DNA to amino acids
        Returns : A Bio::Seq object

        Args    : Either a sequence object or a string of
                  just DNA sequence characters

        Title   : translate_as_string
        Usage   : $seqstring = translate_as_string($seq_or_string_scalar)

        Function: translates a DNA sequence object OR just a plain
                  string of DNA to amino acids
        Returns : A string of just amino acids

        Args    : Either a sequence object or a string of
                  just DNA sequence characters

        Title   : reverse_complement
        Usage   : $seqobj = reverse_complement($seq_or_string_scalar)

        Function: reverse complements a string or sequence argument
                  producing a Bio::Seq - if you want a string, you
                  can use reverse_complement_as_string
        Returns : A Bio::Seq object

        Args    : Either a sequence object or a string of
                  just DNA sequence characters

        Title   : revcom
        Usage   : $seqobj = revcom($seq_or_string_scalar)

        Function: reverse complements a string or sequence argument
                  producing a Bio::Seq - if you want a string, you
                  can use reverse_complement_as_string

                  This is an alias for reverse_complement
        Returns : A Bio::Seq object

        Args    : Either a sequence object or a string of
                  just DNA sequence characters

        Title   : reverse_complement_as_string
        Usage   : $string = reverse_complement_as_string($seq_or_string_scalar)

        Function: reverse complements a string or sequence argument
                  producing a string
        Returns : A string of DNA letters

        Args    : Either a sequence object or a string of
                  just DNA sequence characters

        Title   : revcom_as_string
        Usage   : $string = revcom_as_string($seq_or_string_scalar)

        Function: reverse complements a string or sequence argument
                  producing a string
        Returns : A string of DNA letters

        Args    : Either a sequence object or a string of
                  just DNA sequence characters