Provided by: libbio-perl-perl_1.6.901-2_all bug

NAME

       Bio::PrimarySeq - Bioperl lightweight Sequence Object

SYNOPSIS

         # Bio::SeqIO for file reading, Bio::DB::GenBank for
         # database reading

         use Bio::Seq;
         use Bio::SeqIO;
         use Bio::DB::GenBank;

         # make from memory

         $seqobj = Bio::PrimarySeq->new ( -seq => 'ATGGGGTGGGCGGTGGGTGGTTTG',
                                          -id  => 'GeneFragment-12',
                                          -accession_number => 'X78121',
                                          -alphabet => 'dna',
                                          -is_circular => 1 );
         print "Sequence ", $seqobj->id(), " with accession ",
           $seqobj->accession_number, "\n";

         # read from file

         $inputstream = Bio::SeqIO->new(-file => "myseq.fa",
                                        -format => 'Fasta');
         $seqobj = $inputstream->next_seq();
         print "Sequence ", $seqobj->id(), " and desc ", $seqobj->desc, "\n";

         # to get out parts of the sequence.

         print "Sequence ", $seqobj->id(), " with accession ",
           $seqobj->accession_number, " and desc ", $seqobj->desc, "\n";

         $string  = $seqobj->seq();
         $string2 = $seqobj->subseq(1,40);

DESCRIPTION

       PrimarySeq is a lightweight Sequence object, storing the sequence, its name, a computer-
       useful unique name, and other fundamental attributes.  It does not contain sequence
       features or other information.  To have a sequence with sequence features you should use
       the Seq object which uses this object.

       Although new users will use Bio::PrimarySeq a lot, in general you will be using it from
       the Bio::Seq object. For more information on Bio::Seq see Bio::Seq. For interest you might
       like to know that Bio::Seq has-a Bio::PrimarySeq and forwards most of the function calls
       to do with sequence to it (the has-a relationship lets us get out of a otherwise nasty
       cyclical reference in Perl which would leak memory).

       Sequence objects are defined by the Bio::PrimarySeqI interface, and this object is a pure
       Perl implementation of the interface. If that's gibberish to you, don't worry. The take
       home message is that this object is the bioperl default sequence object, but other people
       can use their own objects as sequences if they so wish. If you are interested in wrapping
       your own objects as compliant Bioperl sequence objects, then you should read the
       Bio::PrimarySeqI documentation

       The documentation of this object is a merge of the Bio::PrimarySeq and Bio::PrimarySeqI
       documentation.  This allows all the methods which you can call on sequence objects here.

FEEDBACK

   Mailing Lists
       User feedback is an integral part of the evolution of this and other Bioperl modules. Send
       your comments and suggestions preferably to one of the Bioperl mailing lists.  Your
       participation is much appreciated.

         bioperl-l@bioperl.org                  - General discussion
         http://bioperl.org/wiki/Mailing_lists  - About the mailing lists

   Support
       Please direct usage questions or support issues to the mailing list:

       bioperl-l@bioperl.org

       rather than to the module maintainer directly. Many experienced and reponsive experts will
       be able look at the problem and quickly address it. Please include a thorough description
       of the problem with code and data examples if at all possible.

   Reporting Bugs
       Report bugs to the Bioperl bug tracking system to help us keep track the bugs and their
       resolution.  Bug reports can be submitted via the web:

         https://redmine.open-bio.org/projects/bioperl/

AUTHOR - Ewan Birney

       Email birney@ebi.ac.uk

APPENDIX

       The rest of the documentation details each of the object methods. Internal methods are
       usually preceded with a _

   new
        Title   : new
        Usage   : $seq    = Bio::PrimarySeq->new( -seq => 'ATGGGGGTGGTGGTACCCT',
                                                  -id  => 'human_id',
                                                  -accession_number => 'AL000012',
                                                  );

        Function: Returns a new primary seq object from
                  basic constructors, being a string for the sequence
                  and strings for id and accession_number.

                  Note that you can provide an empty sequence string. However, in
                  this case you MUST specify the type of sequence you wish to
                  initialize by the parameter -alphabet. See alphabet() for possible
                  values.
        Returns : a new Bio::PrimarySeq object
        Args    : -seq         => sequence string
                  -display_id  => display id of the sequence (locus name)
                  -accession_number => accession number
                  -primary_id  => primary id (Genbank id)
                  -version     => version number
                  -namespace   => the namespace for the accession
                  -authority   => the authority for the namespace
                  -description => description text
                  -desc        => alias for description
                  -alphabet    => sequence type (alphabet) (dna|rna|protein)
                  -id          => alias for display id
                  -is_circular => boolean field for whether or not sequence is circular
                  -direct      => boolean field for directly setting sequence (requires alphabet also set)
                  -ref_to_seq  => boolean field indicating the sequence is a reference (?!?)
                  -nowarnonempty => boolean field for whether or not to warn when sequence is empty

   seq
        Title   : seq
        Usage   : $string    = $obj->seq()
        Function: Returns the sequence as a string of letters. The
                  case of the letters is left up to the implementer.
                  Suggested cases are upper case for proteins and lower case for
                  DNA sequence (IUPAC standard), but you should not rely on this.
        Returns : A scalar
        Args    : Optionally on set the new value (a string). An optional second
                  argument presets the alphabet (otherwise it will be guessed).

   validate_seq
        Title   : validate_seq
        Usage   : if(! $seq->validate_seq($seq_str) ) {
                       print "sequence $seq_str is not valid for an object of
                       alphabet ",$seq->alphabet, "\n";
                  }
        Function: Validates a given sequence string. A validating sequence string
                  must be accepted by seq(). A string that does not validate will
                  lead to an exception if passed to seq().

                  The implementation provided here does not take alphabet() into
                  account. Allowed are all letters (A-Z) and '-','.','*','?','=',
                  and '~'.

        Example :
        Returns : 1 if the supplied sequence string is valid for the object, and
                  0 otherwise.
        Args    : The sequence string to be validated.

   subseq
        Title   : subseq
        Usage   : $substring = $obj->subseq(10,40);
                  $substring = $obj->subseq(10,40,NOGAP)
                  $substring = $obj->subseq(-START=>10,-END=>40,-REPLACE_WITH=>'tga')
        Function: returns the subseq from start to end, where the first sequence
                  character has coordinate 1 number is inclusive, ie 1-2 are the
                  first two characters of the sequence
        Returns : a string
        Args    : integer for start position
                  integer for end position
                        OR
                  Bio::LocationI location for subseq (strand honored)
                  Specify -NOGAP=>1 to return subseq with gap characters removed
                  Specify -REPLACE_WITH=>$new_subseq to replace the subseq returned
                  with $new_subseq in the sequence object

   length
        Title   : length
        Usage   : $len = $seq->length();
        Function: Get the length of the sequence in number of symbols (bases
                  or amino acids).

                  You can also set this attribute, even to a number that does
                  not match the length of the sequence string. This is useful
                  if you don''t want to set the sequence too, or if you want
                  to free up memory by unsetting the sequence. In the latter
                  case you could do e.g.

                      $seq->length($seq->length);
                      $seq->seq(undef);

                  Note that if you set the sequence to a value other than
                  undef at any time, the length attribute will be
                  invalidated, and the length of the sequence string will be
                  reported again. Also, we won''t let you lie about the length.

        Example :
        Returns : integer representing the length of the sequence.
        Args    : Optionally, the value on set

   display_id
        Title   : display_id or display_name
        Usage   : $id_string = $obj->display_id();
        Function: returns the display id, aka the common name of the Sequence object.

                  The semantics of this is that it is the most likely string to
                  be used as an identifier of the sequence, and likely to have
                  "human" readability.  The id is equivalent to the ID field of
                  the GenBank/EMBL databanks and the id field of the
                  Swissprot/sptrembl database. In fasta format, the >(\S+) is
                  presumed to be the id, though some people overload the id to
                  embed other information. Bioperl does not use any embedded
                  information in the ID field, and people are encouraged to use
                  other mechanisms (accession field for example, or extending
                  the sequence object) to solve this.

                  With the new Bio::DescribeableI interface, display_name aliases
                  to this method.

        Returns : A string
        Args    : None

   accession_number
        Title   : accession_number or object_id
        Usage   : $unique_key = $obj->accession_number;
        Function: Returns the unique biological id for a sequence, commonly
                  called the accession_number. For sequences from established
                  databases, the implementors should try to use the correct
                  accession number. Notice that primary_id() provides the
                  unique id for the implemetation, allowing multiple objects
                  to have the same accession number in a particular implementation.

                  For sequences with no accession number, this method should
                  return "unknown".

                  [Note this method name is likely to change in 1.3]

                  With the new Bio::IdentifiableI interface, this is aliased
                  to object_id

        Returns : A string
        Args    : A string (optional) for setting

   primary_id
        Title   : primary_id
        Usage   : $unique_key = $obj->primary_id;
        Function: Returns the unique id for this object in this
                  implementation. This allows implementations to manage their
                  own object ids in a way the implementaiton can control
                  clients can expect one id to map to one object.

                  For sequences with no natural primary id, this method
                  should return a stringified memory location.

        Returns : A string
        Args    : A string (optional, for setting)

   alphabet
        Title   : alphabet
        Usage   : if( $obj->alphabet eq 'dna' ) { /Do Something/ }
        Function: Get/Set the alphabet of sequence, one of
                  'dna', 'rna' or 'protein'. This is case sensitive.

                  This is not called <type> because this would cause
                  upgrade problems from the 0.5 and earlier Seq objects.

        Returns : a string either 'dna','rna','protein'. NB - the object must
                  make a call of the type - if there is no alphabet specified it
                  has to guess.
        Args    : optional string to set : 'dna' | 'rna' | 'protein'

   desc
        Title   : desc or description
        Usage   : $obj->desc($newval)
        Function: Get/set description of the sequence.

                  'description' is an alias for this for compliance with the
                  Bio::DescribeableI interface.

        Example :
        Returns : value of desc (a string)
        Args    : newvalue (a string or undef, optional)

   can_call_new
        Title   : can_call_new
        Usage   :
        Function:
        Example :
        Returns : true
        Args    :

   id
        Title   : id
        Usage   : $id = $seq->id()
        Function: This is mapped on display_id
        Example :
        Returns :
        Args    :

   is_circular
        Title   : is_circular
        Usage   : if( $obj->is_circular) { /Do Something/ }
        Function: Returns true if the molecule is circular
        Returns : Boolean value
        Args    : none

Methods for Bio::IdentifiableI compliance

   object_id
        Title   : object_id
        Usage   : $string    = $obj->object_id()
        Function: A string which represents the stable primary identifier
                  in this namespace of this object. For DNA sequences this
                  is its accession_number, similarly for protein sequences.

                  This is aliased to accession_number().
        Returns : A scalar

   version
        Title   : version
        Usage   : $version    = $obj->version()
        Function: A number which differentiates between versions of
                  the same object. Higher numbers are considered to be
                  later and more relevant, but a single object described
                  the same identifier should represent the same concept.

        Returns : A number

   authority
        Title   : authority
        Usage   : $authority    = $obj->authority()
        Function: A string which represents the organisation which
                  granted the namespace, written as the DNS name for
                  organisation (eg, wormbase.org).

        Returns : A scalar

   namespace
        Title   : namespace
        Usage   : $string    = $obj->namespace()
        Function: A string representing the name space this identifier
                  is valid in, often the database name or the name
                  describing the collection.

        Returns : A scalar

Methods for Bio::DescribableI compliance

       This comprises of display_name and description.

   display_name
        Title   : display_name
        Usage   : $string    = $obj->display_name()
        Function: A string which is what should be displayed to the user.
                  The string should have no spaces (ideally, though a cautious
                  user of this interface would not assumme this) and should be
                  less than thirty characters (though again, double checking
                  this is a good idea).

                  This is aliased to display_id().
        Returns : A scalar

   description
        Title   : description
        Usage   : $string    = $obj->description()
        Function: A text string suitable for displaying to the user a
                  description. This string is likely to have spaces, but
                  should not have any newlines or formatting - just plain
                  text. The string should not be greater than 255 characters
                  and clients can feel justified at truncating strings at 255
                  characters for the purposes of display.

                  This is aliased to desc().
        Returns : A scalar

Methods Inherited from Bio::PrimarySeqI

       These methods are available on Bio::PrimarySeq, although they are actually implemented on
       Bio::PrimarySeqI

   revcom
        Title   : revcom
        Usage   : $rev = $seq->revcom()
        Function: Produces a new Bio::SeqI implementing object which
                  is the reversed complement of the sequence. For protein
                  sequences this throws an exception of
                  "Sequence is a protein. Cannot revcom".

                  The id is the same id as the orginal sequence, and the
                  accession number is also indentical. If someone wants to
                  track that this sequence has be reversed, it needs to
                  define its own extensions.

                  To do an inplace edit of an object you can go:

                  $seqobj = $seqobj->revcom();

                  This of course, causes Perl to handle the garbage
                  collection of the old object, but it is roughly speaking as
                  efficient as an inplace edit.

        Returns : A new (fresh) Bio::SeqI object
        Args    : none

   trunc
        Title   : trunc
        Usage   : $subseq = $myseq->trunc(10,100);
        Function: Provides a truncation of a sequence,

        Example :
        Returns : A fresh Bio::SeqI implementing object.
        Args    :

Internal methods

       These are internal methods to PrimarySeq

   _guess_alphabet
        Title   : _guess_alphabet
        Usage   :
        Function: Automatically guess and set the type of sequence: dna, rna or protein
        Example :
        Returns : one of strings 'dna', 'rna' or 'protein'.
        Args    : none