Provided by: libbio-perl-perl_1.6.901-2_all bug

NAME

       Bio::SeqFeature::Primer - Primer Generic SeqFeature

SYNOPSIS

        # set up a single primer that can be used in a PCR reaction

        use Bio::SeqFeature::Primer;

        # initiate a primer with raw sequence
        my $primer=Bio::SeqFeature::Primer->new(-seq=>'CTTTTCATTCTGACTGCAACG');

        # get the primery tag for the primer # should return Primer
        my $tag=$primer->primary_tag;

        # get or set the location that the primer binds to the target at
        $primer->location(500);
        my $location=$primer->location(500);

        # get or set the 5' end of the primer homology, as the primer doesn't
        # have to be the same as the target sequence
        $primer->start(2);
        my $start=$primer->start;

        # get or set the 3' end of the primer homology
        $primer->end(19);
        my $end = $primer->end;

        # get or set the strand of the primer. Strand should be 1, 0, or -1
        $primer->strand(-1);
        my $strand=$primer->strand;

        # get or set the id of the primer
        $primer->display_id('test_id');
        my $id=$primer->display_id;

        # get the tm of the primer. This is calculated for you by the software.
        # however, see the docs.
        my $tm = $primer->Tm;

        print "These are the details of the primer:\n\tTag:\t\t$tag\n\tLocation\t$location\n\tStart:\t\t$start\n";
        print "\tEnd:\t\t$end\n\tStrand:\t\t$strand\n\tID:\t\t$id\n\tTm:\t\t$tm\n";

DESCRIPTION

       Handle primer sequences. This will allow you to generate a primer object required for a
       Bio::Seq::PrimedSeq object. This module is designed to integrate with Bio::Tools::Primer3
       and Bio::Seq::PrimedSeq.

       In addition, you can calculate the melting temperature of the primer.

       This module is supposed to implement location and range, presumably through generic.pm,
       but does not do so yet. However, it does allow you to set primers, and use those objects
       as the basis for Bio::Seq::PrimedSeq objects.

       See also the POD for Bio::Seq::PrimedSeq and Bio::Tools::Nucleotide::Analysis::Primer3

FEEDBACK

   Mailing Lists
       User feedback is an integral part of the evolution of this and other Bioperl modules. Send
       your comments and suggestions preferably to one of the Bioperl mailing lists.  Your
       participation is much appreciated.

         bioperl-l@bioperl.org                  - General discussion
         http://bioperl.org/wiki/Mailing_lists  - About the mailing lists

   Support
       Please direct usage questions or support issues to the mailing list:

       bioperl-l@bioperl.org

       rather than to the module maintainer directly. Many experienced and reponsive experts will
       be able look at the problem and quickly address it. Please include a thorough description
       of the problem with code and data examples if at all possible.

   Reporting Bugs
       Report bugs to the Bioperl bug tracking system to help us keep track the bugs and their
       resolution.  Bug reports can be submitted via the web:

         https://redmine.open-bio.org/projects/bioperl/

AUTHOR

       Rob Edwards, redwards@utmem.edu

       The original concept and much of the code was written by Chad Matsalla,
       bioinformatics1@dieselwurks.com

APPENDIX

               The rest of the documentation details each of the object
               methods. Internal methods are usually preceded with a _

   new()
        Title   : new()
        Usage   : $primer = Bio::SeqFeature::Primer(-seq=>sequence_object);
        Function: Instantiate a new object
        Returns : A SeqPrimer object
        Args    : You must pass either a sequence object (preferable) or a sequence.

   seq()
        Title   : seq()
        Usage   : $seq = $primer->seq();
        Function: Return the sequence associated with this Primer.
        Returns : A Bio::Seq object
        Args    : None.

   source_tag()
        Title   : source_tag()
        Usage   : $tag = $feature->source_tag();
        Function: Returns the source of this tag.
        Returns : A string.
        Args    : If an argument is provided, the source of this SeqFeature
                  is set to that argument.

   location()
        Title   : location()
        Usage   : $tag = $primer->location();
        Function: Gets or sets the location of the primer on the sequence
        Returns : If the location is set, returns that, if not returns 0.
                  Note: At the moment I am using the primer3 notation of location
                  (although you can set whatever you want).
                  In this form, both primers are given from their 5' ends and a length.
                  In this case, the left primer is given from the leftmost end, but
                  the right primer is given from the rightmost end.
                  You can use start() and end() to get the leftmost and rightmost base
                  of each sequence.
        Args    : If supplied will set a location

   start()
        Title   : start()
        Usage   : $start_position = $primer->start($new_position);
        Function: Return the start position of this Primer.
                  This is the leftmost base, regardless of whether it is a left or right primer.
        Returns : The start position of this primer or 0 if not set.
        Args    : If supplied will set a start position.

   end()
        Title   : end()
        Usage   : $end_position = $primer->end($new_position);
        Function: Return the end position of this primer.
                  This is the rightmost base, regardless of whether it is a left or right primer.
        Returns : The end position of this primer.
        Args    : If supplied will set an end position.

   strand()
        Title   : strand()
        Usage   : $strand=$primer->strand()
        Function: Get or set the strand.
        Returns : The strand that the primer binds to.
        Args    :  If an argument is supplied will set the strand, otherwise will return it. Should be 1, 0 (not set), or -1

   display_id()
        Title   : display_id()
        Usage   : $id = $primer->display_id($new_id)
        Function: Returns the display ID for this Primer feature
        Returns : A scalar.
        Args    : If an argument is provided, the display_id of this primer is
                  set to that value.

   Tm()
         Title   : Tm()
         Usage   : $tm = $primer->Tm(-salt=>'0.05', -oligo=>'0.0000001')
         Function: Calculates and returns the Tm (melting temperature) of the primer
         Returns : A scalar containing the Tm.
         Args    : -salt  : set the Na+ concentration on which to base the calculation
                            (default=0.05 molar).
                 : -oligo : set the oligo concentration on which to base the
                            calculation (default=0.00000025 molar).
         Notes   : Calculation of Tm as per Allawi et. al Biochemistry 1997
                   36:10581-10594. Also see documentation at
                   http://www.idtdna.com/Scitools/Scitools.aspx as they use this
                   formula and have a couple nice help pages. These Tm values will be
                   about are about 0.5-3 degrees off from those of the idtdna web tool.
                   I don't know why.

                   This was suggested by Barry Moore (thanks!). See the discussion on
                   the bioperl-l with the subject "Bio::SeqFeature::Primer Calculating
                   the PrimerTM"

   Tm_estimate
        Title   : Tm_estimate
        Usage   : $tm = $primer->Tm_estimate(-salt=>'0.05')
        Function: Calculates and returns the Tm (melting temperature) of the primer
        Returns : A scalar containing the Tm.
        Args    : -salt set the Na+ concentration on which to base the calculation.
        Notes   : This is an estimate of the Tm that is kept in for comparative reasons.
                  You should probably use Tm instead!

                  This Tm calculations are taken from the Primer3 docs: They are
                  based on Bolton and McCarthy, PNAS 84:1390 (1962)
                  as presented in Sambrook, Fritsch and Maniatis,
                  Molecular Cloning, p 11.46 (1989, CSHL Press).

                  Tm = 81.5 + 16.6(log10([Na+])) + .41*(%GC) - 600/length

                  where [Na+] is the molar sodium concentration, %GC is the
                  %G+C of the sequence, and length is the length of the sequence.

                  However.... I can never get this calculation to give me the same result
                  as primer3 does. Don't ask why, I never figured it out. But I did
                  want to include a Tm calculation here because I use these modules for
                  other things besides reading primer3 output.

                  The primer3 calculation is saved as 'PRIMER_LEFT_TM' or 'PRIMER_RIGHT_TM'
                  and this calculation is saved as $primer->Tm so you can get both and
                  average them!