Provided by: libbio-perl-perl_1.6.924-3_all bug

NAME

       Bio::Map::Microsatellite - An object representing a Microsatellite marker.

SYNOPSIS

         $o_usat = Bio::Map::Microsatellite->new
             (-name=>'Chad Super Marker 2',
              -sequence => 'gctgactgatcatatatatatatatatatatatatatatatcgcgatcgtga',
              -motif => 'at',
              -repeats => 15,
              -repeat_start_position => 11
              );

         $sequence_before_usat = $o_usat->get_leading_flank();
         $sequence_after_usat = $o_usat->get_trailing_flank();

DESCRIPTION

       This object handles the notion of an Microsatellite. This microsatellite can be placed on
       a (linear) Map or used on its own.  If this Microsatellites will be used in a mapping
       context (it doesn't have to, you know) it can have multiple positions in a map. For
       information about a Microsatellite's position in a map one must query the associate
       PositionI object which is accessible through the position() method.

FEEDBACK

   Mailing Lists
       User feedback is an integral part of the evolution of this and other Bioperl modules. Send
       your comments and suggestions preferably to the Bioperl mailing list.  Your participation
       is much appreciated.

         bioperl-l@bioperl.org                  - General discussion
         http://bioperl.org/wiki/Mailing_lists  - About the mailing lists

   Support
       Please direct usage questions or support issues to the mailing list:

       bioperl-l@bioperl.org

       rather than to the module maintainer directly. Many experienced and reponsive experts will
       be able look at the problem and quickly address it. Please include a thorough description
       of the problem with code and data examples if at all possible.

   Reporting Bugs
       Report bugs to the Bioperl bug tracking system to help us keep track of the bugs and their
       resolution. Bug reports can be submitted via the web:

         https://github.com/bioperl/bioperl-live/issues

AUTHOR - Chad Matsalla

       Email bioinformatics1@dieselwurks.com

CONTRIBUTORS

       Heikki Lehvaslaiho heikki-at-bioperl-dot-org Lincoln Stein      lstein@cshl.org Jason
       Stajich      jason@bioperl.org Sendu Bala         bix@sendu.me.uk

APPENDIX

       The rest of the documentation details each of the object methods.  Internal methods are
       usually preceded with a _

   new
        Title   : new
        Usage   : $o_usat =
        Function: Builds a new Bio::Map::Microsatellite object
        Returns : Bio::Map::Microsatellite
        Args    :
               -name    => name of this microsatellite (optional, string,
                       default 'Unknown microsatellite')
               -positions => position(s) for this marker in maps[optional],
                       An array reference of tuples (array refs themselves)
                       Each tuple conatins a Bio::Map::MapI-inherited object and a
                       Bio::Map::PositionI-inherited obj, no default)
               -sequence => the sequence of this microsatellite (optional,
                        scalar, no default)
               -motif => the repeat motif of this microsatellite (optional,
                        scalar, no default)
               -repeats => the number of motif repeats for this microsatellite
                       (optional, scalar, no default)
               -repeat_start_position => the starting position of the
                       microsatellite in this sequence. The first base of the
                       sequence is position "1". (optional, scalar, no default)

        Note    : Creating a Bio::Map::Microsatellite object with no position
               might be useful for microsatellite people wanting to embrace
               and extend this module. <raising hand> Me! Me! Me!
               - using repeat_start_position will trigger a mechinism to
               calculate a value for repeat_end_position.

   motif
        Title   : motif
        Usage   : $o_usat->motif($new_motif);
                      my $motif = $o_usat->motif();
        Function: Get/Set the repeat motif for this Microsatellite.
        Returns : A scalar representing the current repeat motif of this
                      Microsatellite.
        Args    : none to get, OR string to set

   sequence
        Title   : sequence
        Usage   : $o_usat->sequence($new_sequence);
                      my $sequence = $o_usat->sequence();
        Function: Get/Set the sequence for this Microsatellite.
        Returns : A scalar representing the current sequence of this
                      Microsatellite.
        Args    : none to get, OR string to set

   repeats
        Title   : repeats
        Usage   : $o_usat->repeats($new_repeats);
                      my $repeats = $o_usat->repeats()
        Function: Get/Set the repeat repeats for this Microsatellite.
        Returns : A scalar representing the current number of repeats of this
                      Microsatellite.
        Args    : none to get, OR int to set

   repeat_start_position
        Title   : repeat_start_position
        Usage   : $o_usat->repeat_start_position($new_repeat_start_position);
                      my $repeat_start_position = $o_usat->repeat_start_position();
        Function: Get/Set the repeat repeat_start_position for this
                      Microsatellite
        Returns : A scalar representing the repeat start position for this
                      Microsatellite.
        Args    : none to get, OR string to set
                      This method will also try to set the repeat end position. This
                      depends on having information for the motif and the number of
                      repeats. If you want to use methods like get_trailing_flank or
                      get_leading flank, be careful to include the right information.

   repeat_end_position
        Title   : repeat_end_position
        Usage   : $o_usat->repeat_end_position("set");
                      $o_usat->repeat_end_position($value);
                      $current_repeat_end_position = $o_usat->repeat_end_position();
        Function: Get/set the end position of the repeat in this sequence.
        Returns : A scalar representing the base index of the end of the
                      repeat in this Microsatellite. The first base in the sequence
                      is base 1.
        Args    : A scalar representing a value, the string "set", or no
                      argument (see Notes).
        Notes   : If you do not provide an argument to this method, the current
                  end position of the repeat in this Microsatellite will be
                  returned (a scalar).
                  If you provide the string "set" to this method it will set the
                  end position based on the start position, the length of the
                  motif, and the number of repeats.
                  If you specify a value the current end position of the repeat
                  will be set to that value. This is a really bad idea. Don't do
                  it.

   equals
        Title   : equals
        Usage   : if ($mappable->equals($mapable2)) {...}
        Function: Test if a position is equal to another position
        Returns : boolean
        Args    : Bio::Map::MappableI

   less_than
        Title   : less_than
        Usage   : if ($mappable->less_than($m2)) {...}
        Function: Tests if a position is less than another position
        Returns : boolean
        Args    : Bio::Map::MappableI

   greater_than
        Title   : greater_than
        Usage   : if ($mappable->greater_than($m2)) {...}
        Function: Tests if position is greater than another position
        Returns : boolean
        Args    : Bio::Map::MappableI

   get_leading_flank
        Title   : get_leading_flank
        Usage   : $leading_sequence = $o_usat->get_leading_flank();
        Returns : A scalar representing the sequence before the repeats in this
                      Microsatellite.
        Args    : none

   get_trailing_flank
        Title   : get_trailing_flank
        Usage   : $trailing_flank = $o_usat->get_trailing_flank();
        Returns : A scalar representing the sequence after the repeats in this
                      Microsatellite.
        Args    : none