Provided by: fastx-toolkit_0.0.14-5_amd64 bug

NAME

       fastx_barcode_splitter.pl - FASTX Barcode Splitter

DESCRIPTION

       Barcode Splitter, by Assaf Gordon (gordon@cshl.edu), 11sep2008

       This  program reads FASTA/FASTQ file and splits it into several smaller files, Based on barcode matching.
       FASTA/FASTQ data is read from STDIN (format is auto-detected.)  Output files  will  be  writen  to  disk.
       Summary will be printed to STDOUT.

       usage: r.pl --bcfile FILE --prefix PREFIX [--suffix SUFFIX] [--bol|--eol]

              [--mismatches N] [--exact] [--partial N] [--help] [--quiet] [--debug]

       Arguments:

       --bcfile  FILE    -  Barcodes file name. (see explanation below.)  --prefix PREFIX - File prefix. will be
       added to the output files. Can be used

              to specify output directories.

       --suffix SUFFIX - File suffix (optional). Can be used to specify file

              extensions.

       --bol           - Try to match barcodes at the BEGINNING of sequences.

              (What biologists would call the 5' end, and programmers would call index 0.)

       --eol           - Try to match barcodes at the END of sequences.

              (What biologists would call the 3' end, and programmers would call the end of the string.)   NOTE:
              one of --bol, --eol must be specified, but not both.

       --mismatches  N   -  Max.  number  of  mismatches  allowed.  default  is  1.   --exact          - Same as
       '--mismatches 0'. If both --exact and --mismatches

              are specified, '--exact' takes precedence.

       --partial N     - Allow partial overlap of barcodes. (see explanation below.)

              (Default is not partial matching)

       --quiet         - Don't print counts and summary at the end of the run.

              (Default is to print.)

       --debug         - Print lots of useless debug information to STDERR.  --help          - This helpful help
       screen.

       Example (Assuming 's_2_100.txt' is a FASTQ file, 'mybarcodes.txt' is the barcodes file):

              $ cat s_2_100.txt | fastx_barcode_splitter.pl --bcfile mybarcodes.txt --bol --mismatches 2 \

       --prefix /tmp/bla_ --suffix ".txt"

       Barcode file format ------------------- Barcode files are simple text files. Each line should contain  an
       identifier  (descriptive  name  for  the  barcode),  and the barcode itself (A/C/G/T), separated by a TAB
       character. Example:

              #This line is a comment (starts with a 'number' sign) BC1 GATCT BC2 ATCGT BC3 GTGAT BC4 TGTCT

       For each barcode, a new FASTQ file will be created (with the barcode's identifier as  part  of  the  file
       name). Sequences matching the barcode will be stored in the appropriate file.

       Running  the  above  example  (assuming  "mybarcodes.txt"  contains  the above barcodes), will create the
       following files:

              /tmp/bla_BC1.txt /tmp/bla_BC2.txt /tmp/bla_BC3.txt /tmp/bla_BC4.txt /tmp/bla_unmatched.txt

       The 'unmatched' file will contain all sequences that didn't match any barcode.

       Barcode matching ----------------

       ** Without partial matching:

       Count mismatches between the FASTA/Q sequences and the barcodes.  The  barcode  which  matched  with  the
       lowest mismatches count (providing the count is small or equal to '--mismatches N') 'gets' the sequences.

       Example (using the above barcodes): Input Sequence:

              GATTTACTATGTAAAGATAGAAGGAATAAGGTGAAG

   Matching with '--bol --mismatches 1':
              GATTTACTATGTAAAGATAGAAGGAATAAGGTGAAG  GATCT  (1  mismatch, BC1) ATCGT (4 mismatches, BC2) GTGAT (3
              mismatches, BC3) TGTCT (3 mismatches, BC4)

       This sequence will be classified  as  'BC1'  (it  has  the  lowest  mismatch  count).   If  '--exact'  or
       '--mismatches  0' were specified, this sequence would be classified as 'unmatched' (because, although BC1
       had the lowest mismatch count, it is above the maximum allowed mismatches).

       Matching with '--eol' (end of line) does the same, but from the other side of the sequence.

       ** With partial matching (very similar to indels):

       Same as above, with the following addition: barcodes are also checked  for  partial  overlap  (number  of
       allowed non-overlapping bases is '--partial N').

       Example:  Input  sequence is ATTTACTATGTAAAGATAGAAGGAATAAGGTGAAG (Same as above, but note the missing 'G'
       at the beginning.)

   Matching (without partial overlapping) against BC1 yields 4 mismatches:
              ATTTACTATGTAAAGATAGAAGGAATAAGGTGAAG GATCT (4 mismatches)

   Partial overlapping would also try the following match:

       -ATTTACTATGTAAAGATAGAAGGAATAAGGTGAAG

              GATCT (1 mismatch)

       Note: scoring counts a missing base as a mismatch, so the final mismatch count is 2 (1 'real' mismatch, 1
       'missing base' mismatch).  If running with '--mismatches 2' (meaning allowing upto 2 mismatches)  -  this
       seqeunce will be classified as BC1.

SEE ALSO

       The quality of this automatically generated manpage might be insufficient.  It is suggested to visit

              http://hannonlab.cshl.edu/fastx_toolkit/commandline.html

       to get a better layout as well as an overview about connected FASTX tools.

fastx_barcode_splitter.pl 0.0.14                   August 2017                      FASTX_BARCODE_SPLITTER.PL(1)