Ubuntu Manpage: sambamba-view - tool for extracting information from SAM/BAM/CRAM files

name
synopsis
description
filtering
json
options
examples
see also

NAME

       sambamba-view - tool for extracting information from SAM/BAM/CRAM files

SYNOPSIS

       sambamba view OPTIONS <input.bam | input.sam | input.cram> [region1 [...]]

DESCRIPTION

       sambamba  view  allows  to  efficiently  filter  SAM/BAM/CRAM  files  for  alignments  satisfying various
       conditions, as well as access its SAM header and information about reference sequences. In order to  make
       these data readily available for consumption by scripts in Perl/Python/Ruby, JSON output is provided.

       By  default,  the  tool expects BAM file as an input. In order to work with CRAM, specify -C and for SAM,
       specify -S|--sam-input as a command-line option, the tool does NOT try to  guess  file  format  from  the
       extension.  Beware  that  when  reading  SAM,  the tool will skip tags which don´t conform to the SAM/BAM
       specification, and set invalid fields to their default values.

FILTERING

       Filtering is presented in two ways. First, you can specify a condition with -F option,  using  a  special
       language for filtering, described at

       https://github.com/lomereiter/sambamba/wiki/%5Bsambamba-view%5D-Filter-expression-syntax

       Second, if you have an indexed BAM file, several regions can be specified as well. The syntax for regions
       is the same as in samtools: chr:beg-end where beg and end are 1-based  start  and  end  of  a  closed-end
       interval on the reference chr.

JSON

       Alignment  record  JSON  representation  is  a  hash  with  keys ´qname´, ´flag´, ´rname´, ´pos´, ´mapq´,
       ´cigar´, ´rnext´, ´qual´, ´tags´, e.g.

       {"qname":"EAS56_57:6:190:289:82","flag":69,"rname":"chr1","pos":100,
       "mapq":0,"cigar":"*","rnext":"=","pnext":100,"tlen":0,
       "seq":"CTCAAGGTTGTTGCAAGGGGGTCTATGTGAACAAA",
       "qual":[27,27,27,22,27,27,27,26,27,27,27,27,27,27,27,27,23,26,26,27,
       22,26,19,27,26,27,26,26,26,26,26,24,19,27,26],"tags":{"MF":192}}

       JSON representation mimics SAM format except quality is given as an array of integers.

       Postprocessing JSON output is best accomplished with https://stedolan.github.io/jq/

       The output is one line per read, for building a proper JSON array pipe the output into jq --slurp.

OPTIONS

-F, --filter=FILTER
Set custom filter for alignments.

-f, --format=FORMAT
Specify output format. FORMAT must be one of sam, bam, cram, or json (in lowercase). Default is
SAM.

-h, --with-header
Print SAM header before reads. This is always done for BAM output.

-H, --header
Print only SAM header to STDOUT. If FORMAT is sam or bam, its text version is printed, otherwise
JSON object is written.

-I, --reference-info
Output to STDOUT reference sequence names and lengths in JSON (see EXAMPLES).

-L, --regions=BEDFILE
Intersect a file with regions specified in the BED file.

-c, --count
Output to STDOUT only the number of matching records, -hHI options are ignored.

-v, --valid
Output only valid reads.

-S, --sam-input
Specify that the input is SAM file (default is BAM for all operations).

-C, --cram-input
Specify that input is in CRAM format

-p, --show-progress
Show progressbar in STDERR. Works only for BAM files, and with no regions specified, i.e. only
when reading full file.

-l, --compression-level=COMPRESSION_LEVEL
Set compression level for BAM output, a number from 0 to 9.

-o, --output-filename=FILENAME
Specify output filename (by default everything is written to STDOUT).

-t, --nthreads=NTHREADS
Number of threads to use.

EXAMPLES

       Print basic reference sequence information:

            $ sambamba view --reference-info ex1_header.bam
            [{"name":"chr1","length":1575},{"name":"chr2","length":1584}]

       Count reads with mapping quality not less than 50:

            $ sambamba view -c -F "mapping_quality >= 50" ex1_header.bam
            3124

       Count properly paired reads overlapping 100..200 on chr1:

            $ sambamba view -c -F "proper_pair" ex1_header.bam chr1:100-200
            39

       Output header in JSON format:

            $ sambamba view --header --format=json ex1_header.bam
            {"format_version":"1.3","rg_lines":[],
             "sq_lines":[{"sequence_length":1575,"species":"","uri":"",
             "sequence_name":"chr1","assembly":"","md5":""},
             {"sequence_length":1584,"species":"","uri":"",
             "sequence_name":"chr2","assembly":"","md5":""}],
             "sorting_order":"coordinate","pg_lines":[]}