Bio::SeqFeature::SubSeq
Feature representing a subsequence
- Provided by: libbio-perl-perl (Version: 1.7.2-2)
- Source: bioperl
- Report a bug
Feature representing a subsequence
# SubSeq with implicit sequence
use Bio::Seq;
my $template = Bio::Seq->new( -seq => 'AAAAACCCCCGGGGGTTTTT' );
$subseq = Bio::SeqFeature::Amplicon->new(
-start => 6,
-end => 15,
-template => $template,
);
print "Subsequence is: ".$amplicon->seq->seq."\n"; # Should be 'CCCCCGGGGG'
# SubSeq with explicit sequence
use Bio::SeqFeature::Subseq;
my $subseq = Bio::SeqFeature::Amplicon->new(
-seq => $seq_object,
);
Bio::SeqFeature::SubSeq extends Bio::SeqFeature::Generic features to represent a subsequence. When this feature is attached to a template sequence, the sequence of feature is the subsequence of the template at this location. The purpose of this class is to represent a sequence as a feature without having to explicitly store its sequence string.
Of course, you might have reasons to explicitly set a sequence. In that case, note that the length of the sequence is allowed to not match the position of the feature. For example, you can set sequence of length 10 in a SubSeq feature that spans positions 30 to 50 of the template if you so desire.
User feedback is an integral part of the evolution of this and other Bioperl modules. Send your comments and suggestions preferably to one of the Bioperl mailing lists. Your participation is much appreciated.
bioperl-l@bioperl.org - General discussion http://bioperl.org/wiki/Mailing_lists - About the mailing lists
Please direct usage questions or support issues to the mailing list:
bioperl-l@bioperl.org
rather than to the module maintainer directly. Many experienced and reponsive experts will be able look at the problem and quickly address it. Please include a thorough description of the problem with code and data examples if at all possible.
Report bugs to the Bioperl bug tracking system to help us keep track the bugs and their resolution. Bug reports can be submitted via the web:
https://github.com/bioperl/bioperl-live/issues
Florent Angly <florent.angly@gmail.com>
The rest of the documentation details each of the object methods. Internal methods are usually preceded with a _
Title : new()
Usage : my $subseq = Bio::SeqFeature::SubSeq( -start => 1, -end => 10, -strand => -1);
Function: Instantiate a new Bio::SeqFeature::SubSeq feature object
Args : -seq , the sequence object or sequence string of the feature (optional)
-template , attach the feature to the provided parent template sequence or feature (optional).
Note that you must specify the feature location to do this.
-start, -end, -location, -strand and all other L<Bio::SeqFeature::Generic> argument can be used.
Returns : A Bio::SeqFeature::SubSeq object
Title : seq()
Usage : my $seq = $subseq->seq();
Function: Get or set the sequence object of this SubSeq feature. If no sequence
was provided, but the subseq is attached to a sequence, get the
corresponding subsequence.
Returns : A sequence object or undef
Args : None.
Title : seq()
Usage : my $length = $subseq->seq();
Function: Get the length of the SubSeq feature. It is similar to the length()
method of L<Bio::Generic::SeqFeature>, which computes length based
on the location of the feature. However, if the feature was not
given a location, return the length of the subsequence if possible.
Returns : integer or undef
Args : None.