Provided by: libbio-perl-perl_1.7.2-2_all bug

NAME

       Bio::Tools::Analysis::DNA::ESEfinder - a wrapper around ESEfinder server

SYNOPSIS

         use Bio::Tools::Analysis::DNA::ESEfinder;
         use strict;

         my $seq; # a Bio::PrimarySeqI or Bio::SeqI object

         $seq = Bio::Seq->new(
              -primary_id => 'test',
              -seq=>'atgcatgctaggtgtgtgttttgtgggttgtactagctagtgat'.
              -alphabet=>'dna');

         my $ese_finder = Bio::Tools::Analysis::DNA::ESEfinder->
             new(-seq => $seq);

         # run ESEfinder prediction on a DNA sequence
         $ese_finder->run();

         die "Could not get a result"
             unless $ese_finder->status =~ /^COMPLETED/;

         print $ese_finder->result;      # print raw prediction to STDOUT

         foreach my $feat ( $ese_finder->result('Bio::SeqFeatureI') ) {

             # do something to SeqFeature
             # e.g. print as GFF
             print $feat->gff_string, "\n";
             # or store within the sequence - if it is a Bio::SeqI
             $seq->add_SeqFeature($feat)

         }

DESCRIPTION

       This class is a wrapper around the ESEfinder web server which uses experimentally defined scoring
       matrices to identify possible exonic splicing enhancers in human transcripts.

       The results can be retrieved in 4 ways.

       1.  "$ese_finder->result('')" retrieves the raw text output of the program

       2.  "$ese_finder->result('all')" returns a Bio::Seq::Meta::Array object with prediction scores for all
           residues in the sequence

       3.  "$ese_finder->result('Bio::SeqFeatureI')" returns an array of Bio::SeqFeature objects for sequences
           with significant scores. Feature tags are score, motif, SR_protein and method

       4.  "$ese_finder->result('raw')" returns an array of significant matches with each element being a
           reference to [SR_protein, position, motif, score]

       See <http://rulai.cshl.edu/tools/ESE2/>

       This the second implementation of Bio::SimpleAnalysisI which hopefully will make it easier to write
       wrappers on various services. This class uses a web resource and therefore inherits from Bio::WebAgent.

SEE ALSO

       Bio::SimpleAnalysisI, Bio::WebAgent

FEEDBACK

   Mailing Lists
       User feedback is an integral part of the evolution of this and other Bioperl modules. Send your comments
       and suggestions preferably to one of the Bioperl mailing lists.  Your participation is much appreciated.

         bioperl-l@bioperl.org                  - General discussion
         http://bioperl.org/wiki/Mailing_lists  - About the mailing lists

   Support
       Please direct usage questions or support issues to the mailing list:

       bioperl-l@bioperl.org

       rather than to the module maintainer directly. Many experienced and reponsive experts will be able look
       at the problem and quickly address it. Please include a thorough description of the problem with code and
       data examples if at all possible.

   Reporting Bugs
       Report bugs to the Bioperl bug tracking system to help us keep track the bugs and their resolution.  Bug
       reports can be submitted via the web:

         https://github.com/bioperl/bioperl-live/issues

AUTHORS

       Richard Adams, Richard.Adams@ed.ac.uk, Heikki Lehvaslaiho, heikki-at-bioperl-dot-org

APPENDIX

       The rest of the documentation details each of the object methods. Internal methods are usually preceded
       with a _