Provided by: seqprep_1.3.2-5_amd64 bug

NAME

       seqprep - merge paired end Illumina reads

       SeqPrep  is  a program to merge paired end Illumina reads that are overlapping into a single longer read.
       It may also just be used for its adapter trimming feature without doing any paired end overlap.

USAGE

       seqprep required args [options]

Required Arguments:

       -f <first read input fastq filename>
       -r <second read input fastq filename>
       -1 <first read output fastq filename>
       -2 <second read output fastq filename>

General Arguments (Optional):

       -3 <first read discarded fastq filename>
       -4 <second read discarded fastq filename>
       -h Display this help message and exit (also works with no args)
       -6 Input sequence is in phred+64 rather than phred+33 format, the output will still be phred+33
       -q <Quality score cutoff for mismatches to be counted in overlap; default = 13>
       -L <Minimum length of a trimmed or merged read to print it; default = 30>

Arguments for Adapter/Primer Trimming (Optional):

       -A <forward read primer/adapter sequence to trim as it would appear at the end of a read (recommend about 20bp of this)
            (should validate by grepping a file); default (genomic non-multiplexed adapter1) = AGATCGGAAGAGCGGTTCAG>
       -B <reverse read primer/adapter sequence to trim as it would appear at the end of a read (recommend about 20bp of this)
            (should validate by grepping a file); default (genomic non-multiplexed adapter2) = AGATCGGAAGAGCGTCGTGT>
       -O <minimum overall base pair overlap with adapter sequence to trim; default = 10>
       -M <maximum fraction of good quality mismatching bases for primer/adapter overlap; default = 0.020000>
       -N <minimum fraction of matching bases for primer/adapter overlap; default = 0.870000>
       -b <adapter alignment band-width; default = 50>
       -Q <adapter alignment gap-open; default = 8>
       -t <adapter alignment gap-extension; default = 2>
       -e <adapter alignment gap-end; default = 2>
       -Z <adapter alignment minimum local alignment score cutoff [roughly (2*num_hits) - (num_gaps*gap_open) - (num_gaps*gap_close) - (gap_len*gap_extend) - (2*num_mismatches)]; default = 26>
       -w <read alignment band-width; default = 50>
       -W <read alignment gap-open; default = 26>
       -p <read alignment gap-extension; default = 9>
       -P <read alignment gap-end; default = 5>
       -X <read alignment maximum fraction gap cutoff; default = 0.125000>

Optional Arguments for Merging:

       -y <maximum quality score in output ((phred 33) default = ´]´ )>
       -g <print overhang when adapters are present and stripped (use this if reads are different length)> - UNIMPLEMENTED
       -s <perform merging and output the merged reads to this file>
       -E <write pretty alignments to this file for visual Examination>
       -x <max number of pretty alignments to write (if -E provided); default = 10000>
       -o <minimum overall base pair overlap to merge two reads; default = 15>
       -m <maximum fraction of good quality mismatching bases to overlap reads; default = 0.020000>
       -n <minimum fraction of matching bases to overlap reads; default = 0.900000>

       NOTE 1: The output is always gziped compressed.

       NOTE 2: If the quality strings in the output contain characters less than asciii 33  on  an  ascii  table
       (they look like lines from a binary file), try running again with or without the -6 option.

SETUP

       When  an  adapter sequence is present, that means that the two reads must overlap (in most cases) so they
       are forcefully merged. When reads do not have adapter sequence they must be treated with care when  doing
       the  merging,  so  a  much  more  specific  approach  is  taken.  The default parameters were chosen with
       specificity in mind, so that they could be ran on libraries where very few reads are expected to overlap.
       It is always safest though to save the overlapping procedure for libraries  where  you  have  some  prior
       knowledge that a significant portion of the reads will have some overlap.

       Before  running  SeqPrep  make  sure to check that the program´s defaults are indeed the adapters you are
       looking for. Try copying the default forward adapter from this file and grep it against your reads  doing
       a  word  count,  also  try the same with the reverse adapter with grep. You should see some hits. You can
       also try using (and validating with grep) -A GATCGGAAGAGCACACG -B AGATCGGAAGAGCGTCGT  as  parameters.  To
       find   a   list   of   Illumina   adapter   sequences   you   should   write  to  Illumina  tech  support
       TechSupport@illumina.com (they do not like people to  share  the  list  of  sequences  outside  of  their
       institution).

       Choose about 20bp of an adapter sequence where:

       1.  You see the most hits with grep.

       2.  When  you run a command like zcat Lane2_0d_2.fastq.gz | head -n 1000000 |grep "INSERT ADAPTER HERE" |
           head you see the adapter sequence show up at the beginning of  a  few  reads.  Also  the  -A  and  -B
           arguments  should  be  as  they  show  up in your data, SeqPrep searches directly for these sequences
           without doing reverse complementing

       3.  Check the forward and reverse and make sure that you have roughly the  same  number  of  hits  via  a
           command  to count hits like: zcat Lane2_0d_2.fastq.gz | head -n 1000000 |grep "INSERT ADAPTER HERE" |
           wc -l As an additional precaution, the program checks for good read overlap  once  the  adapters  are
           trimmed.  If  the  adapter is trimmed and the reads do not have a reasonable adapter overlap (you can
           modify this setting with -X) then the reads aren´t printed or merged.

       See Test/README.md  for  some  information  on  testing  out  other  parameters.  Test/SimTest  has  some
       particularly  cool  test  data  which  you  can  use  to check out sensitivity and specificity of adapter
       trimming using different parameters. The results of the test are displayed in results.html which uses the
       google charts API so that the points are interactive and you can easily  determine  which  settings  made
       which points.

       LOW COMPLEXITY ALIGNMENTS

       My current strategy to deal with ambiguous alignments to low complexity regions is as follows:

       I  have  some minimum requirements for an overlap to be accepted After the first one is found (ie the one
       with the maximal overlap between the two sequences), if low  complexity  filtering  is  enabled,  I  keep
       searching  if a second viable hit is found, I give up and say that it is not a good idea to merge the two
       reads. I check for ambiguous alignments in read overlapping, but not in adapter trimming where  the  most
       conservative  thing to do is strip the most aggressively aligned adapter (The closest to the beginning of
       the read).

       To accept an alignment I allow some fraction of mismatches (currently the floor of 0.06 of the  alignment
       length  for  adapter  and  0.02 of the alignment length for two reads). That means that in most cases for
       overlapping two reads I don´t allow any mismatches between  adjacent  reads,  but  if  there  is  a  50bp
       potential overlap with 1 mismatch over q20 for example, I allow it. Anything below 50 needs to be perfect
       other than with low quality bases.

       Since  we  ignore poor quality bases, we could have the case where a single real match followed by a long
       string of poor quality bases to the end of the read would result in a called overlap. That seemed like  a
       bad  idea. To get around that I require that at least some fraction of the overlapping length be matches.
       Right now I have that parameter set at 0.7 for adapter trimming and 0.75 for read merging, so for a  case
       where only the last 10 bases overlap, at least 7 of those must be matches.

       Since  doing  that  many  floating  point multiplications seems like a bad idea, I just have a table that
       pre-calculates all of those min matches and max mismatch numbers for  every  overlap  length  up  to  the
       maximum allowed read length.

       Finally  I  have  a  parameter  you can set which specifies a minimum resulting read length after adapter
       trimming and/or merging so that ultra short trimmed reads aren´t output.

       Following are results from hand testing the three main  merge  cases.  Now  to  generate  similar  output
       automatically  just  supply  the -E readable_alignment.txt.gz argument to the program (the output is gzip
       compressed into the file name specified).

Sequence Merge No Adapter Present:

       QUER: NCCTGCTACTACCACCCGTTCCGTGCCTGGAGCCTGCATGTTGGGCAGATACGTGCTGCCACAGCCTGTCTCTGCTGGTGCCTGGGCCTC
                           ||  |||||||||||| || |  |||||||||||||||||||||||||||||||||
       SUBJ:                                   TGTGTGTTGGGCAGATGCGGGGGGCCACAGCCTGTCTCTGCTGGTGCCTGGGCCTCTCCTGTTCCTTGCCCACGTCTCCGTCTCCTGTTG
       RESU: NCCTGCTACTACCACCCGTTCCGTGCCTGGAGCCTGCATGTTGGGCAGATACGTGCTGCCACAGCCTGTCTCTGCTGGTGCCTGGGCCTCTCCTGTTCCTTGCCCACGTCTCCGTCTCCTGTTG
       Quality Merge:
       QUER: !223387787@@@CCC22C@@@@@@@@@@@@@@@@@@@@@@@@@@@@?@@89887:::::.2125@@:@@:::::@@@@@<<::8@@@@@
       SUBJ:                                   !!!!!!!!!!!!!!!!!!!!!!!!!!!@@@8DEGE@EDDBB2<BBE@EHBFE@EE>D8@DBE>BFIDH@IIEEIIBEIEIIGBIIGIFII
       RESU: !223387787@@@CCC22C@@@@@@@@@@@@@@@@@@@@@@@@@@@@?@@89887:::::.QPQLSSSSSSSSSSQSSSSSSSSSSSSSSD8@DBE>BFIDH@IIEEIIBEIEIIGBIIGIFII

Sequence Merge Adapter Present, Easy Peezy Mode (same lengths):

       SUBJ: NGATATGATTCCCAATCTAAGCAAACTGTCATGGAAAC
          |||||||||||||||||||||||||||||||||||||
       QUER: GGATATGATTCCCAATCTAAGCAAACTGTCATGGAAAC
       RESU: GGATATGATTCCCAATCTAAGCAAACTGTCATGGAAAC
       Quality Merge:
       SUBJ: !.-/.53444@@@@@@@@@@@@@@@@@@@@@@@@@@@@
       QUER: IHGIIIDIIHGEHIGHIFHIFIIIIHIIIIIIIIIHII
       RESU: ISSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS

Sequence merge Adapter but lengths differ:

       SUBJ: AATTGATGGGTGCCCACCCACGGGCCAGACAAAATCATCTGGCAAGCTGGATGCAGCCTACAAGCTGTAAGATTGGA
         |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
       QUER: AATTGATGGGTGCCCACCCACGGGCCAGACAAAATCATCTGGCAAGCTGGATGCAGCCTACAAGCTGTA
       RESU: AATTGATGGGTGCCCACCCACGGGCCAGACAAAATCATCTGGCAAGCTGGATGCAGCCTACAAGCTGTAAGATTGGA
       Quality Merge:
       SUBJ: =DEC??DDBD?4B=BEE@@@GB>GEE:DE8=2::6GDGBGEGDD<=;A?=AGGGG=5.=<BD?B?DDB>B4725:E>
       QUER: GDDBBFBGGFBHFIEDGGGBDGGG<GGDDG@IIIEIHDIHGIIIDDGDGDFDIFIHGIDEGGGDIIIGI
       RESU: SSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSB4725:E>

       If interested there is a website where I post my tests of different parameters for SeqPrep  on  simulated
       data.  There  are  also a few comparison stats of different programs to trim adapters. The website can be
       accessed here: http://hgwdev.cse.ucsc.edu/~jstjohn/seqprep/ where the pages are named  result(date).html.
       The latest ones (as of when I have gotten around to edit this) can be found here:

       http://hgwdev.cse.ucsc.edu/~jstjohn/seqprep/results2011-09-15.html

       Note  that  although my program is more sensitive and specific than fastq-clipper, I optomized my default
       parameters based on this test. Results on real data may be different, although I believe my method  takes
       advantage of a more realistic adapter model than other software does. For example, even though my program
       requires 10bp of adapter to be present at the end of a read to trim it off (by default) there is a backup
       adapter  trimming  function  that trimms based on strong and unambiguous read overlap. Because of this my
       program can trim the adapter even if it is only present in the last few bases of the read.

       Also note that fastq-mcf appears to do a little better at sensitivity (0.992 vs 0.985) at  a  very  large
       cost to specificity (0.497 vs 0.994).

AUTHOR

       ○   All content by John St. John

       ○   Manpage edited for Debian by Tim Booth

Cancer Therapeutics Innovation Group              November 2017                                       SEQPREP(1)