Provided by: adapterremoval_2.3.1-3build1_amd64 
NAME
AdapterRemoval - Fast short-read adapter trimming and processing
SYNOPSIS
AdapterRemoval [options…] –file1 <filenames> [–file2 <filenames>]
DESCRIPTION
AdapterRemoval removes residual adapter sequences from single-end (SE) or paired-end (PE)
FASTQ reads, optionally trimming Ns and low qualities bases and/or collapsing overlapping
paired-end mates into one read. Low quality reads are filtered based on the resulting
length and the number of ambigious nucleotides (‘N’) present following trimming. These
operations may be combined with simultaneous demultiplexing using 5’ barcode sequences.
Alternatively, AdapterRemoval may attempt to reconstruct a consensus adapter sequences
from paired-end data, in order to allow the identification of the adapter sequences
originally used.
If you use this program, please cite the paper:
Schubert, Lindgreen, and Orlando (2016). AdapterRemoval v2: rapid adapter trimming,
identification, and read merging. BMC Research Notes, 12;9(1):88
http://bmcresnotes.biomedcentral.com/articles/10.1186/s13104-016-1900-2
For detailed documentation, please see
http://adapterremoval.readthedocs.io/en/v2.2.3/
OPTIONS
--help Display summary of command-line options.
--version
Print the version string.
--file1 filename [filenames...]
Read FASTQ reads from one or more files, either uncompressed, bzip2 compressed, or
gzip compressed. This contains either the single-end (SE) reads or, if paired-end,
the mate 1 reads. If running in paired-end mode, both --file1 and --file2 must be
set. See the primary documentation for a list of supported formats.
--file2 filename [filenames...]
Read one or more FASTQ files containing mate 2 reads for a paired-end run. If
specified, --file1 must also be set.
--identify-adapters
Attempt to build a consensus adapter sequence from fully overlapping pairs of
paired-end reads. The minimum overlap is controlled by --minalignmentlength. The
result will be compared with the values set using --adapter1 and --adapter2. No
trimming is performed in this mode. Default is off.
--threads n
Maximum number of threads. Defaults to 1.
FASTQ options
--qualitybase base
The Phred quality scores encoding used in input reads - either ‘64’ for Phred+64
(Illumina 1.3+ and 1.5+) or ‘33’ for Phred+33 (Illumina 1.8+). In addition, the
value ‘solexa’ may be used to specify reads with Solexa encoded scores. Default is
33.
--qualitybase-output base
The base of the quality score for reads written by AdapterRemoval - either ‘64’ for
Phred+64 (i.e., Illumina 1.3+ and 1.5+) or ‘33’ for Phred+33 (Illumina 1.8+). In
addition, the value ‘solexa’ may be used to specify reads with Solexa encoded
scores. However, note that quality scores are represented using Phred scores
internally, and conversion to and from Solexa scores therefore result in a loss of
information. The default corresponds to the value given for --qualitybase.
--qualitymax base
Specifies the maximum Phred score expected in input files, and used when writing
output files. Possible values are 0 to 93 for Phred+33 encoded files, and 0 to 62
for Phred+64 encoded files. Defaults to 41.
--mate-separator separator
Character separating the mate number (1 or 2) from the read name in FASTQ records.
Defaults to ‘/’.
--interleaved
Enables --interleaved-input and --interleaved-output.
--interleaved-input
If set, input is expected to be a interleaved FASTQ files specified using --file1,
in which pairs of reads are written one after the other (e.g. read1/1, read1/2,
read2/1, read2/2, etc.).
--interleaved-ouput
Write paired-end reads to a single file, interleaving mate 1 and mate 2 reads. By
default, this file is named basename.paired.truncated, but this may be changed
using the --output1 option.
--combined-output
Write all reads into the files specified by --output1 and --output2. The sequences
of reads discarded due to quality filters or read merging are replaced with a
single ‘N’ with Phred score 0. This option can be combined with
--interleaved-output to write PE reads to a single output file specified with
--output1.
Output file options
--basename filename
Prefix used for the naming output files, unless these names have been overridden
using the corresponding command-line option (see below).
--settings file
Output file containing information on the parameters used in the run as well as
overall statistics on the reads after trimming. Default filename is
‘basename.settings’.
--output1 file
Output file containing trimmed mate1 reads. Default filename is
‘basename.pair1.truncated’ for paired-end reads, ‘basename.truncated’ for
single-end reads, and ‘basename.paired.truncated’ for interleaved paired-end reads.
--output2 file
Output file containing trimmed mate 2 reads when --interleaved-output is not
enabled. Default filename is ‘basename.pair2.truncated’ in paired-end mode.
--singleton file
Output file to which containing paired reads for which the mate has been discarded.
Default filename is ‘basename.singleton.truncated’.
--outputcollapsed file
If –collapsed is set, contains overlapping mate-pairs which have been merged into a
single read (PE mode) or reads for which the adapter was identified by a minimum
overlap, indicating that the entire template molecule is present. This does not
include which have subsequently been trimmed due to low-quality or ambiguous
nucleotides. Default filename is ‘basename.collapsed’
--outputcollapsedtruncated file
Collapsed reads (see –outputcollapsed) which were trimmed due the presence of
low-quality or ambiguous nucleotides. Default filename is
‘basename.collapsed.truncated’.
--discarded file
Contains reads discarded due to the –minlength, –maxlength or –maxns options.
Default filename is ‘basename.discarded’.
Output compression options
--gzip If set, all FASTQ files written by AdapterRemoval will be gzip compressed using the
compression level specified using --gzip-level. The extension “.gz” is added to
files for which no filename was given on the command-line. Defaults to off.
--gzip-level level
Determines the compression level used when gzip’ing FASTQ files. Must be a value in
the range 0 to 9, with 0 disabling compression and 9 being the best compression.
Defaults to 6.
--bzip2
If set, all FASTQ files written by AdapterRemoval will be bzip2 compressed using
the compression level specified using --bzip2-level. The extension “.bz2” is added
to files for which no filename was given on the command-line. Defaults to off.
--bzip2-level level
Determines the compression level used when bzip2’ing FASTQ files. Must be a value
in the range 1 to 9, with 9 being the best compression. Defaults to 9.
FASTQ trimming options
--adapter1 adapter
Adapter sequence expected to be found in mate 1 reads, specified in read direction.
For a detailed description of how to provide the appropriate adapter sequences, see
the “Adapters” section of the online documentation. Default is
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG.
--adapter2 adapter
Adapter sequence expected to be found in mate 2 reads, specified in read direction.
For a detailed description of how to provide the appropriate adapter sequences, see
the “Adapters” section of the online documentation. Default is
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT.
--adapter-list filename
Read one or more adapter sequences from a table. The first two columns (separated
by whitespace) of each line in the file are expected to correspond to values passed
to –adapter1 and –adapter2. In single-end mode, only column one is required. Lines
starting with ‘#’ are ignored. When multiple rows are found in the table,
AdapterRemoval will try each adapter (pair), and select the best aligning adapters
for each FASTQ read processed.
--minadapteroverlap length
In single-end mode, reads are only trimmed if the overlap between read and the
adapter is at least X bases long, not counting ambiguous nucleotides (N); this is
independent of the --minalignmentlength when using --collapse, allowing a
conservative selection of putative complete inserts in single-end mode, while
ensuring that all possible adapter contamination is trimmed. The default is 0.
--mm mismatchrate
The allowed fraction of mismatches allowed in the aligned region. If the value is
less than 1, then the value is used directly. If `--mismatchrate is greater than 1,
the rate is set to 1 / --mismatchrate. The default setting is 3 when trimming
adapters, corresponding to a maximum mismatch rate of 1/3, and 10 when using
--identify-adapters.
--shift n
To allow for missing bases in the 5’ end of the read, the program can let the
alignment slip --shift bases in the 5’ end. This corresponds to starting the
alignment maximum --shift nucleotides into read2 (for paired-end) or the adapter
(for single-end). The default is 2.
--trim5p n [n]
Trim the 5’ of reads by a fixed amount after removing adapters, but before carrying
out quality based trimming. Specify one value to trim mate 1 and mate 2 reads the
same amount, or two values separated by a space to trim each mate different
amounts. Off by default.
--trim3p n [n]
Trim the 3’ of reads by a fixed amount. See --trim5p.
--trimns
Trim consecutive Ns from the 5’ and 3’ termini. If quality trimming is also enabled
(--trimqualities), then stretches of mixed low-quality bases and/or Ns are trimmed.
--maxns n
Discard reads containing more than --max ambiguous bases (‘N’) after trimming.
Default is 1000.
--trimqualities
Trim consecutive stretches of low quality bases (threshold set by --minquality)
from the 5’ and 3’ termini. If trimming of Ns is also enabled (--trimns), then
stretches of mixed low-quality bases and Ns are trimmed.
--trimwindows window_size
Trim low quality bases using a sliding window based approach inspired by sickle
with the given window size. See the “Window based quality trimming” section of the
manual page for a description of this algorithm.
--minquality minimum
Set the threshold for trimming low quality bases using --trimqualities and
--trimwindows. Default is 2.
--preserve5p
If set, bases at the 5p will not be trimmed by --trimns, --trimqualities, and
--trimwindows. Collapsed reads will not be quality trimmed when this option is
enabled.
--minlength length
Reads shorter than this length are discarded following trimming. Defaults to 15.
--maxlength length
Reads longer than this length are discarded following trimming. Defaults to
4294967295.
FASTQ merging options
--collapse
In paired-end mode, merge overlapping mates into a single and recalculate the
quality scores. In single-end mode, attempt to identify templates for which the
entire sequence is available. In both cases, complete “collapsed” reads are written
with a ‘M_’ name prefix, and “collapsed” reads which are trimmed due to quality
settings are written with a ‘MT_’ name prefix. The overlap needs to be at least
--minalignmentlength nucleotides, with a maximum number of mismatches determined by
--mm.
--minalignmentlength length
The minimum overlap between mate 1 and mate 2 before the reads are collapsed into
one, when collapsing paired-end reads, or when attempting to identify complete
template sequences in single-end mode. Default is 11.
--seed seed
When collaping reads at positions where the two reads differ, and the quality of
the bases are identical, AdapterRemoval will select a random base. This option
specifies the seed used for the random number generator used by AdapterRemoval.
This value is also written to the settings file. Note that setting the seed is not
reliable in multithreaded mode, since the order of operations is non-deterministic.
--deterministic
Enable deterministic mode; currently only affects –collapse, different overlapping
bases with equal quality are set to N quality 0, instead of being randomly sampled.
FASTQ demultiplexing options
--barcode-list filename
Perform demultiplxing using table of one or two fixed-length barcodes for SE or PE
reads. The table is expected to contain 2 or 3 columns, the first of which
represent the name of a given sample, and the second and third of which represent
the mate 1 and (optionally) the mate 2 barcode sequence. For a detailed
description, see the “Demultiplexing” section of the online documentation.
--barcode-mm n
Maximum number of mismatches allowed when counting mismatches in both the mate 1 and the
mate 2 barcode for paired reads.
--barcode-mm-r1 n
Maximum number of mismatches allowed for the mate 1 barcode; if not set, this value
is equal to the --barcode-mm value; cannot be higher than the --barcode-mm value.
--barcode-mm-r2 n
Maximum number of mismatches allowed for the mate 2 barcode; if not set, this value
is equal to the --barcode-mm value; cannot be higher than the --barcode-mm value.
--demultiplex-only
Only carry out demultiplexing using the list of barcodes supplied with
–barcode-list. No other processing is done.
WINDOW BASED QUALITY TRIMMING
As of v2.2.2, AdapterRemoval implements sliding window based approach to quality based
base-trimming inspired by sickle. If window_size is greater than or equal to 1, that
number is used as the window size for all reads. If window_size is a number greater than
or equal to 0 and less than 1, then that number is multiplied by the length of individual
reads to determine the window size. If the window length is zero or is greater than the
current read length, then the read length is used instead.
Reads are trimmed as follows for a given window size:
1. The new 5’ is determined by locating the first window where both the average quality
and the quality of the first base in the window is greater than --minquality.
2. The new 3’ is located by sliding the first window right, until the average quality
becomes less than or equal to --minquality. The new 3’ is placed at the last base in
that window where the quality is greater than or equal to --minquality.
3. If no 5’ position could be determined, the read is discarded.
EXIT STATUS
AdapterRemoval exists with status 0 if the program ran succesfully, and with a non-zero
exit code if any errors were encountered. Do not use the output from AdapterRemoval if the
program returned a non-zero exit code!
REPORTING BUGS
Please report any bugs using the AdapterRemoval issue-tracker:
https://github.com/MikkelSchubert/adapterremoval/issues
LICENSE
This program is free software; you can redistribute it and/or modify it under the terms of
the GNU General Public License as published by the Free Software Foundation; either
version 3 of the License, or at your option any later version.
This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY;
without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.
See the GNU General Public License for more details.
You should have received a copy of the GNU General Public License along with this program.
If not, see <http://www.gnu.org/licenses/>.
AUTHOR
Mikkel Schubert; Stinus Lindgreen
COPYRIGHT
2017, Mikkel Schubert; Stinus Lindgreen