Provided by: emboss_6.6.0+dfsg-7ubuntu2_amd64 
NAME
eprimer32 - Picks PCR primers and hybridization oligos
SYNOPSIS
eprimer32 -sequence seqall [-primer toggle] -task list [-hybridprobe toggle]
-mishyblibraryfile infile -mispriminglibraryfile infile [-numreturn integer]
[-includedregion range] [-targetregion range] [-excludedregion range]
[-forwardinput string] [-reverseinput string] -gcclamp integer -osize integer
-minsize integer -maxsize integer -otm float -mintm float -maxtm float
-maxdifftm float -ogcpercent float -mingc float -maxgc float -saltconc float
-dnaconc float -maxpolyx integer -psizeopt integer -prange range -ptmopt float
-ptmmin float -ptmmax float -oexcludedregion range -oligoinput string
-osizeopt integer -ominsize integer -omaxsize integer -otmopt float
-otmmin float -otmmax float -ogcopt float -ogcmin float -ogcmax float
-osaltconc float -odnaconc float -oanyself float -oendself float
-opolyxmax integer -omishybmax float -explainflag boolean -fileflag boolean
-firstbaseindex integer -pickanyway boolean -maxmispriming float
-pairmaxmispriming float -numnsaccepted integer -selfany float -selfend float
-scorrection list -tmformula list -maxendstability float -outfile outfile
eprimer32 -help
DESCRIPTION
eprimer32 is a command line program from EMBOSS (“the European Molecular Biology Open
Software Suite”). It is part of the "Nucleic:Primers" command group(s).
OPTIONS
Input section
-sequence seqall
The sequence from which to choose primers. The sequence must be presented 5' to 3'
-primer toggle
Tell Eprimer32 to pick primer(s) Default value: Y
-task list
Tell Eprimer32 what task to perform. Legal values are 1: 'Pick PCR primers', 2: 'Pick
forward primer only', 3: 'Pick reverse primer only', 4: 'No primers needed'. Default
value: 1
-hybridprobe toggle
An 'internal oligo' is intended to be used as a hybridization probe (hyb probe) to
detect the PCR product after amplification. Default value: N
-mishyblibraryfile infile
Similar to MISPRIMING-LIBRARY, except that the event we seek to avoid is hybridization
of the internal oligo to sequences in this library rather than priming from them. The
file must be in (a slightly restricted) FASTA format (W. B. Pearson and D.J. Lipman,
PNAS 85:8 pp 2444-2448 [1988]); we briefly discuss the organization of this file
below. If this parameter is specified then Eprimer32 locally aligns each candidate
oligo against each library sequence and rejects those primers for which the local
alignment score times a specified weight (see below) exceeds
INTERNAL-OLIGO-MAX-MISHYB. (The maximum value of the weight is arbitrarily set to
12.0.) Each sequence entry in the FASTA-format file must begin with an 'id line' that
starts with '>'. The contents of the id line is 'slightly restricted' in that
Eprimer32 parses everything after any optional asterisk ('*') as a floating point
number to use as the weight mentioned above. If the id line contains no asterisk then
the weight defaults to 1.0. The alignment scoring system used is the same as for
calculating complementarity among oligos (e.g. SELF-ANY). The remainder of an entry
contains the sequence as lines following the id line up until a line starting with '>'
or the end of the file. Whitespace and newlines are ignored. Characters 'A', 'T', 'G',
'C', 'a', 't', 'g', 'c' are retained and any other character is converted to 'N' (with
the consequence that any IUB / IUPAC codes for ambiguous bases are converted to 'N').
There are no restrictions on line length. An empty value for this parameter indicates
that no library should be used.
-mispriminglibraryfile infile
The name of a file containing a nucleotide sequence library of sequences to avoid
amplifying (for example repetitive sequences, or possibly the sequences of genes in a
gene family that should not be amplified.) The file must be in (a slightly restricted)
FASTA format (W. B. Pearson and D.J. Lipman, PNAS 85:8 pp 2444-2448 [1988]); we
briefly discuss the organization of this file below. If this parameter is specified
then Eprimer32 locally aligns each candidate primer against each library sequence and
rejects those primers for which the local alignment score times a specified weight
(see below) exceeds MAX-MISPRIMING. (The maximum value of the weight is arbitrarily
set to 100.0.) Each sequence entry in the FASTA-format file must begin with an 'id
line' that starts with '>'. The contents of the id line is 'slightly restricted' in
that Eprimer32 parses everything after any optional asterisk ('*') as a floating point
number to use as the weight mentioned above. If the id line contains no asterisk then
the weight defaults to 1.0. The alignment scoring system used is the same as for
calculating complementarity among oligos (e.g. SELF-ANY). The remainder of an entry
contains the sequence as lines following the id line up until a line starting with '>'
or the end of the file. Whitespace and newlines are ignored. Characters 'A', 'T', 'G',
'C', 'a', 't', 'g', 'c' are retained and any other character is converted to 'N' (with
the consequence that any IUB / IUPAC codes for ambiguous bases are converted to 'N').
There are no restrictions on line length. An empty value for this parameter indicates
that no repeat library should be used.
Additional section
Program options
-numreturn integer
The maximum number of primer pairs to return. Primer pairs returned are sorted by
their 'quality', in other words by the value of the objective function (where a lower
number indicates a better primer pair). Caution: setting this parameter to a large
value will increase running time. Default value: 5
Sequence options
-includedregion range
A sub-region of the given sequence in which to pick primers. For example, often the
first dozen or so bases of a sequence are vector, and should be excluded from
consideration. The value for this parameter has the form (start),(end) where (start)
is the index of the first base to consider, and (end) is the last in the
primer-picking region.
-targetregion range
If one or more Targets is specified then a legal primer pair must flank at least one
of them. A Target might be a simple sequence repeat site (for example a CA repeat) or
a single-base-pair polymorphism. The value should be a space-separated list of
(start),(end) pairs where (start) is the index of the first base of a Target, and
(end) is the last E.g. 50,51 requires primers to surround the 2 bases at positions 50
and 51.
-excludedregion range
Primer oligos may not overlap any region specified in this tag. The associated value
must be a space-separated list of (start),(end) pairs where (start) is the index of
the first base of the excluded region, and and (end) is the last. This tag is useful
for tasks such as excluding regions of low sequence quality or for excluding regions
containing repetitive elements such as ALUs or LINEs. E.g. 401,407 68,70 forbids
selection of primers in the 7 bases starting at 401 and the 3 bases at 68.
-forwardinput string
The sequence of a forward primer to check and around which to design reverse primers
and optional internal oligos. Must be a substring of SEQUENCE.
-reverseinput string
The sequence of a reverse primer to check and around which to design forward primers
and optional internal oligos. Must be a substring of the reverse strand of SEQUENCE.
Primer options
-gcclamp integer
Require the specified number of consecutive Gs and Cs at the 3' end of both the
forward and reverse primer. (This parameter has no effect on the internal oligo if one
is requested.)
-osize integer
Optimum length (in bases) of a primer oligo. Eprimer32 will attempt to pick primers
close to this length. Default value: 20
-minsize integer
Minimum acceptable length of a primer. Must be greater than 0 and less than or equal
to MAX-SIZE. Default value: 18
-maxsize integer
Maximum acceptable length (in bases) of a primer. Currently this parameter cannot be
larger than 35. This limit is governed by the maximum oligo size for which Eprimer32's
melting-temperature is valid. Default value: 27
-otm float
Optimum melting temperature(Celsius) for a primer oligo. Eprimer32 will try to pick
primers with melting temperatures are close to this temperature. The oligo melting
temperature formula in Eprimer32 is that given in Rychlik, Spencer and Rhoads, Nucleic
Acids Research, vol 18, num 21, pp 6409-6412 and Breslauer, Frank, Bloecker and Marky,
Proc. Natl. Acad. Sci. USA, vol 83, pp 3746-3750. Please refer to the former paper for
background discussion. Default value: 60.0
-mintm float
Minimum acceptable melting temperature(Celsius) for a primer oligo. Default value:
57.0
-maxtm float
Maximum acceptable melting temperature(Celsius) for a primer oligo. Default value:
63.0
-maxdifftm float
Maximum acceptable (unsigned) difference between the melting temperatures of the
forward and reverse primers. Default value: 100.0
-ogcpercent float
Primer optimum GC percent. Default value: 50.0
-mingc float
Minimum allowable percentage of Gs and Cs in any primer. Default value: 20.0
-maxgc float
Maximum allowable percentage of Gs and Cs in any primer generated by Primer. Default
value: 80.0
-saltconc float
The millimolar concentration of salt (usually KCl) in the PCR. Eprimer32 uses this
argument to calculate oligo melting temperatures. Default value: 50.0
-dnaconc float
The nanomolar concentration of annealing oligos in the PCR. Eprimer32 uses this
argument to calculate oligo melting temperatures. The default (50nM) works well with
the standard protocol used at the Whitehead/MIT Center for Genome Research--0.5
microliters of 20 micromolar concentration for each primer oligo in a 20 microliter
reaction with 10 nanograms template, 0.025 units/microliter Taq polymerase in 0.1 mM
each dNTP, 1.5mM MgCl2, 50mM KCl, 10mM Tris-HCL (pH 9.3) using 35 cycles with an
annealing temperature of 56 degrees Celsius. This parameter corresponds to 'c' in
Rychlik, Spencer and Rhoads' equation (ii) (Nucleic Acids Research, vol 18, num 21)
where a suitable value (for a lower initial concentration of template) is 'empirically
determined'. The value of this parameter is less than the actual concentration of
oligos in the reaction because it is the concentration of annealing oligos, which in
turn depends on the amount of template (including PCR product) in a given cycle. This
concentration increases a great deal during a PCR; fortunately PCR seems quite robust
for a variety of oligo melting temperatures. See ADVICE FOR PICKING PRIMERS. Default
value: 50.0
-maxpolyx integer
The maximum allowable length of a mononucleotide repeat in a primer, for example
AAAAAA. Default value: 5
Product options
-psizeopt integer
The optimum size for the PCR product. 0 indicates that there is no optimum product
size. Default value: 200
-prange range
The associated values specify the lengths of the product that the user wants the
primers to create, and is a space separated list of elements of the form (x)-(y) where
an (x)-(y) pair is a legal range of lengths for the product. For example, if one wants
PCR products to be between 100 to 150 bases (inclusive) then one would set this
parameter to 100-150. If one desires PCR products in either the range from 100 to 150
bases or in the range from 200 to 250 bases then one would set this parameter to
100-150 200-250. Eprimer32 favours ranges to the left side of the parameter string.
Eprimer32 will return legal primers pairs in the first range regardless the value of
the objective function for these pairs. Only if there are an insufficient number of
primers in the first range will Eprimer32 return primers in a subsequent range.
Default value: 100-300
-ptmopt float
The optimum melting temperature for the PCR product. 0 indicates that there is no
optimum temperature. Default value: 0.0
-ptmmin float
The minimum allowed melting temperature of the amplicon. Please see the documentation
on the maximum melting temperature of the product for details. Default value:
-1000000.0
-ptmmax float
The maximum allowed melting temperature of the amplicon. Product Tm is calculated
using the formula from Bolton and McCarthy, PNAS 84:1390 (1962) as presented in
Sambrook, Fritsch and Maniatis, Molecular Cloning, p 11.46 (1989, CSHL Press). Tm =
81.5 + 16.6(log10([Na+])) + .41*(%GC) - 600/length Where [Na+} is the molar sodium
concentration, (%GC) is the percent of Gs and Cs in the sequence, and length is the
length of the sequence. A similar formula is used by the prime primer selection
program in GCG, which instead uses 675.0/length in the last term (after F. Baldino,
Jr, M.-F. Chesselet, and M.E. Lewis, Methods in Enzymology 168:766 (1989) eqn (1) on
page 766 without the mismatch and formamide terms). The formulas here and in Baldino
et al. assume Na+ rather than K+. According to J.G. Wetmur, Critical Reviews in
BioChem. and Mol. Bio. 26:227 (1991) 50 mM K+ should be equivalent in these formulae
to .2 M Na+. Eprimer32 uses the same salt concentration value for calculating both the
primer melting temperature and the oligo melting temperature. If you are planning to
use the PCR product for hybridization later this behavior will not give you the Tm
under hybridization conditions. Default value: 1000000.0
Internal oligo input
-oexcludedregion range
Middle oligos may not overlap any region specified by this tag. The associated value
must be a space-separated list of (start),(end) pairs, where (start) is the index of
the first base of an excluded region, and (end) is the last. Often one would make
Target regions excluded regions for internal oligos.
-oligoinput string
The sequence of an internal oligo to check and around which to design forward and
reverse primers. Must be a substring of SEQUENCE.
Internal oligo options
-osizeopt integer
Optimum length (in bases) of an internal oligo. Eprimer32 will attempt to pick primers
close to this length. Default value: 20
-ominsize integer
Minimum acceptable length of an internal oligo. Must be greater than 0 and less than
or equal to INTERNAL-OLIGO-MAX-SIZE. Default value: 18
-omaxsize integer
Maximum acceptable length (in bases) of an internal oligo. Currently this parameter
cannot be larger than 35. This limit is governed by maximum oligo size for which
Eprimer32's melting-temperature is valid. Default value: 27
-otmopt float
Optimum melting temperature (Celsius) for an internal oligo. Eprimer32 will try to
pick oligos with melting temperatures that are close to this temperature. The oligo
melting temperature formula in Eprimer32 is that given in Rychlik, Spencer and Rhoads,
Nucleic Acids Research, vol 18, num 21, pp 6409-6412 and Breslauer, Frank, Bloecker
and Marky, Proc. Natl. Acad. Sci. USA, vol 83, pp 3746-3750. Please refer to the
former paper for background discussion. Default value: 60.0
-otmmin float
Minimum acceptable melting temperature(Celsius) for an internal oligo. Default value:
57.0
-otmmax float
Maximum acceptable melting temperature (Celsius) for an internal oligo. Default value:
63.0
-ogcopt float
Internal oligo optimum GC percent. Default value: 50.0
-ogcmin float
Minimum allowable percentage of Gs and Cs in an internal oligo. Default value: 20.0
-ogcmax float
Maximum allowable percentage of Gs and Cs in any internal oligo generated by Primer.
Default value: 80.0
-osaltconc float
The millimolar concentration of salt (usually KCl) in the hybridization. Eprimer32
uses this argument to calculate internal oligo melting temperatures. Default value:
50.0
-odnaconc float
The nanomolar concentration of annealing internal oligo in the hybridization. Default
value: 50.0
-oanyself float
The maximum allowable local alignment score when testing an internal oligo for (local)
self-complementarity. Local self-complementarity is taken to predict the tendency of
oligos to anneal to themselves The scoring system gives 1.00 for complementary bases,
-0.25 for a match of any base (or N) with an N, -1.00 for a mismatch, and -2.00 for a
gap. Only single-base-pair gaps are allowed. For example, the alignment 5' ATCGNA 3'
|| | | 3' TA-CGT 5' is allowed (and yields a score of 1.75), but the alignment 5'
ATCCGNA 3' || | | 3' TA--CGT 5' is not considered. Scores are non-negative, and a
score of 0.00 indicates that there is no reasonable local alignment between two
oligos. Default value: 12.00
-oendself float
The maximum allowable 3'-anchored global alignment score when testing a single oligo
for self-complementarity. The scoring system is as for the Maximum Complementarity
argument. In the examples above the scores are 7.00 and 6.00 respectively. Scores are
non-negative, and a score of 0.00 indicates that there is no reasonable 3'-anchored
global alignment between two oligos. In order to estimate 3'-anchored global
alignments for candidate oligos, Primer assumes that the sequence from which to choose
oligos is presented 5' to 3'. INTERNAL-OLIGO-SELF-END is meaningless when applied to
internal oligos used for hybridization-based detection, since primer-dimer will not
occur. We recommend that INTERNAL-OLIGO-SELF-END be set at least as high as
INTERNAL-OLIGO-SELF-ANY. Default value: 12.00
-opolyxmax integer
The maximum allowable length of an internal oligo mononucleotide repeat, for example
AAAAAA. Default value: 5
-omishybmax float
Similar to MAX-MISPRIMING except that this parameter applies to the similarity of
candidate internal oligos to the library specified in INTERNAL-OLIGO-MISHYB-LIBRARY.
Default value: 12.0
Advanced section
-explainflag boolean
If this flag is true, produce LEFT-EXPLAIN, RIGHT-EXPLAIN, and INTERNAL-OLIGO-EXPLAIN
output tags, which are intended to provide information on the number of oligos and
primer pairs that Eprimer32 examined, and statistics on the number discarded for
various reasons. Default value: N
-fileflag boolean
If the associated value is true, then Eprimer32 creates two output files for each
input SEQUENCE. File (sequence-id).for lists all acceptable forward primers for
(sequence-id), and (sequence-id).rev lists all acceptable reverse primers for
(sequence-id), where (sequence-id) is the value of the SEQUENCE-ID tag (which must be
supplied). In addition, if the input tag TASK is 1 or 4, Eprimer32 produces a file
(sequence-id).int, which lists all acceptable internal oligos. Default value: N
-firstbaseindex integer
This parameter is the index of the first base in the input sequence. For input and
output using 1-based indexing (such as that used in GenBank and to which many users
are accustomed) set this parameter to 1. For input and output using 0-based indexing
set this parameter to 0. (This parameter also affects the indexes in the contents of
the files produced when the primer file flag is set.) Default value: 1
-pickanyway boolean
If true pick a primer pair even if LEFT-INPUT, RIGHT-INPUT, or INTERNAL-OLIGO-INPUT
violates specific constraints. Default value: N
-maxmispriming float
The maximum allowed weighted similarity with any sequence in MISPRIMING-LIBRARY.
Default value: 12.00
-pairmaxmispriming float
The maximum allowed sum of weighted similarities of a primer pair (one similarity for
each primer) with any single sequence in MISPRIMING-LIBRARY. Default value: 24.00
-numnsaccepted integer
Maximum number of unknown bases (N) allowable in any primer.
-selfany float
The maximum allowable local alignment score when testing a single primer for (local)
self-complementarity and the maximum allowable local alignment score when testing for
complementarity between forward and reverse primers. Local self-complementarity is
taken to predict the tendency of primers to anneal to each other without necessarily
causing self-priming in the PCR. The scoring system gives 1.00 for complementary
bases, -0.25 for a match of any base (or N) with an N, -1.00 for a mismatch, and -2.00
for a gap. Only single-base-pair gaps are allowed. For example, the alignment 5'
ATCGNA 3' ...|| | | 3' TA-CGT 5' is allowed (and yields a score of 1.75), but the
alignment 5' ATCCGNA 3' ...|| | | 3' TA--CGT 5' is not considered. Scores are
non-negative, and a score of 0.00 indicates that there is no reasonable local
alignment between two oligos. Default value: 8.00
-selfend float
The maximum allowable 3'-anchored global alignment score when testing a single primer
for self-complementarity, and the maximum allowable 3'-anchored global alignment score
when testing for complementarity between forward and reverse primers. The 3'-anchored
global alignment score is taken to predict the likelihood of PCR-priming
primer-dimers, for example 5' ATGCCCTAGCTTCCGGATG 3' .............||| |||||
..........3' AAGTCCTACATTTAGCCTAGT 5' or 5' AGGCTATGGGCCTCGCGA 3'
...............|||||| ............3' AGCGCTCCGGGTATCGGA 5' The scoring system is as
for the Maximum Complementarity argument. In the examples above the scores are 7.00
and 6.00 respectively. Scores are non-negative, and a score of 0.00 indicates that
there is no reasonable 3'-anchored global alignment between two oligos. In order to
estimate 3'-anchored global alignments for candidate primers and primer pairs, Primer
assumes that the sequence from which to choose primers is presented 5' to 3'. It is
nonsensical to provide a larger value for this parameter than for the Maximum (local)
Complementarity parameter because the score of a local alignment will always be at
least as great as the score of a global alignment. Default value: 3.00
-scorrection list
Specifies the salt correction formula for the melting temperature calculation. Default
value: 1
-tmformula list
Specifies details of melting temperature calculation. Default value: 1
Primer penalty weights
-maxendstability float
The maximum stability for the five 3' bases of a forward or reverse primer. Bigger
numbers mean more stable 3' ends. The value is the maximum delta G for duplex
disruption for the five 3' bases as calculated using the nearest neighbor parameters
published in Breslauer, Frank, Bloecker and Marky, Proc. Natl. Acad. Sci. USA, vol 83,
pp 3746-3750. Eprimer32 uses a completely permissive default value for backward
compatibility (which we may change in the next release). Rychlik recommends a maximum
value of 9 (Wojciech Rychlik, 'Selection of Primers for Polymerase Chain Reaction' in
BA White, Ed., 'Methods in Molecular Biology, Vol. 15: PCR Protocols: Current Methods
and Applications', 1993, pp 31-40, Humana Press, Totowa NJ). Default value: 9.0
Output section
-outfile outfile
BUGS
Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or
directly to the EMBOSS developers
(http://sourceforge.net/tracker/?group_id=93650&atid=605031).
SEE ALSO
eprimer32 is fully documented via the tfm(1) system.
AUTHOR
Debian Med Packaging Team <debian-med-packaging@lists.alioth.debian.org>
Wrote the script used to autogenerate this manual page.
COPYRIGHT
This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package.
It can be redistributed under the same terms as EMBOSS itself.