Ubuntu Manpages

Bio::SeqFeature::Primer

Primer Generic SeqFeature

  use Bio::SeqFeature::Primer;
  # Primer object with explicitly-defined sequence object or sequence string
  my $primer = Bio::SeqFeature::Primer->new( -seq => 'ACGTAGCT' );
  $primer->display_name('test_id');
  print "These are the details of the primer:\n".
        "Name:     ".$primer->display_name."\n".  
        "Tag:      ".$primer->primary_tag."\n".   # always 'Primer'
        "Sequence: ".$primer->seq->seq."\n".
        "Tm:       ".$primer->Tm."\n\n";            # melting temperature
  # Primer object with implicit sequence object
  # It is a lighter approach for when the primer location on a template is known
  use Bio::Seq;
  my $template = Bio::Seq->new( -seq => 'ACGTAGCTCTTTTCATTCTGACTGCAACG' );
  $primer   = Bio::SeqFeature::Primer->new( -start => 1, -end =>5, -strand => 1 );
  $template->add_SeqFeature($primer);
  print "Primer sequence is: ".$primer->seq->seq."\n";
  # Primer sequence is 'ACGTA'

This module handles PCR primer sequences. The Bio::SeqFeature::Primer object is a Bio::SeqFeature::Subseq object that can additionally contain a primer sequence and its coordinates on a template sequence. The primary_tag() for this object is 'Primer'. A method is provided to calculate the melting temperature Tm of the primer. Bio::SeqFeature::Primer objects are useful to build Bio::Seq::PrimedSeq amplicon objects such as the ones returned by Bio::Tools::Primer3.

User feedback is an integral part of the evolution of this and other Bioperl modules. Send your comments and suggestions preferably to one of the Bioperl mailing lists. Your participation is much appreciated.

  bioperl-l@bioperl.org                  - General discussion
  http://bioperl.org/wiki/Mailing_lists  - About the mailing lists

Please direct usage questions or support issues to the mailing list:

bioperl-l@bioperl.org

rather than to the module maintainer directly. Many experienced and reponsive experts will be able look at the problem and quickly address it. Please include a thorough description of the problem with code and data examples if at all possible.

Report bugs to the Bioperl bug tracking system to help us keep track the bugs and their resolution. Bug reports can be submitted via the web:

  https://github.com/bioperl/bioperl-live/issues

Rob Edwards, redwards@utmem.edu

The original concept and much of the code was written by Chad Matsalla, bioinformatics1@dieselwurks.com

The rest of the documentation details each of the object methods. Internal methods are usually preceded with a _

new()

 Title   : new()
 Usage   : my $primer = Bio::SeqFeature::Primer( -seq => $seq_object );
 Function: Instantiate a new Bio::SeqFeature::Primer object
 Returns : A Bio::SeqFeature::Primer object
 Args    : -seq , a sequence object or a sequence string (optional)
           -id  , the ID to give to the primer sequence, not feature (optional)

Tm()

 Title   : Tm()
 Usage   : my $tm = $primer->Tm(-salt => 0.05, -oligo => 0.0000001);
 Function: Calculate the Tm (melting temperature) of the primer
 Returns : A scalar containing the Tm.
 Args    : -salt  : set the Na+ concentration on which to base the calculation
                    (default=0.05 molar).
         : -oligo : set the oligo concentration on which to base the
                    calculation (default=0.00000025 molar).
 Notes   : Calculation of Tm as per Allawi et. al Biochemistry 1997
           36:10581-10594. Also see documentation at
           http://www.idtdna.com/Scitools/Scitools.aspx as they use this
           formula and have a couple nice help pages. These Tm values will be
           about are about 0.5-3 degrees off from those of the idtdna web tool.
           I don't know why.
           This was suggested by Barry Moore (thanks!). See the discussion on
           the bioperl-l with the subject "Bio::SeqFeature::Primer Calculating
           the PrimerTM"

 Title   : Tm_estimate
 Usage   : my $tm = $primer->Tm_estimate(-salt => 0.05);
 Function: Estimate the Tm (melting temperature) of the primer
 Returns : A scalar containing the Tm.
 Args    : -salt set the Na+ concentration on which to base the calculation.
 Notes   : This is only an estimate of the Tm that is kept in for comparative
           reasons. You should probably use Tm instead!
           This Tm calculations are taken from the Primer3 docs: They are
           based on Bolton and McCarthy, PNAS 84:1390 (1962) 
           as presented in Sambrook, Fritsch and Maniatis,
           Molecular Cloning, p 11.46 (1989, CSHL Press).
           Tm = 81.5 + 16.6(log10([Na+])) + .41*(%GC) - 600/length
           where [Na+] is the molar sodium concentration, %GC is the
           %G+C of the sequence, and length is the length of the sequence.
           However.... I can never get this calculation to give me the same result
           as primer3 does. Don't ask why, I never figured it out. But I did 
           want to include a Tm calculation here because I use these modules for 
           other things besides reading primer3 output.
           The primer3 calculation is saved as 'PRIMER_LEFT_TM' or 'PRIMER_RIGHT_TM'
           and this calculation is saved as $primer->Tm so you can get both and
           average them!

The documentation of Bio::SeqFeature::Generic describes all the methods that Bio::SeqFeature::Primer object inherit.