Provided by: vienna-rna_2.4.17+dfsg-2build2_amd64 bug

NAME

       RNAfold - manual page for RNAfold 2.4.17

SYNOPSIS

       RNAfold [OPTIONS] [<input0.fa>] [<input1.fa>]...

DESCRIPTION

       RNAfold 2.4.17

       Calculate minimum free energy secondary structures and partition function of RNAs

       The  program reads RNA sequences, calculates their minimum free energy (mfe) structure and
       prints the mfe structure in bracket notation  and  its  free  energy.   If  not  specified
       differently  using  commandline  arguments,  input  is accepted from stdin or read from an
       input file, and output printed to stdout. If the -p option was given it also computes  the
       partition function (pf) and base pairing probability matrix, and prints the free energy of
       the thermodynamic ensemble, the frequency of the mfe structure in the  ensemble,  and  the
       ensemble diversity to stdout.

       It  also  produces  PostScript files with plots of the resulting secondary structure graph
       and a "dot plot" of the base pairing matrix.  The dot plot shows a matrix of squares  with
       area  proportional  to the pairing probability in the upper right half, and one square for
       each pair in the minimum free energy structure in the lower left half. For each  pair  i-j
       with probability p>10E-6 there is a line of the form

       i  j  sqrt(p)  ubox

       in the PostScript file, so that the pair probabilities can be easily extracted.

       Sequences  may  be  provided in a simple text format where each sequence occupies a single
       line. Output files are named "rna.ps" and "dot.ps". Existing files of the same  name  will
       be overwritten.

       It is also possible to provide sequence data in FASTA format. In this case, the first word
       of the FASTA header will be used as  prefix  for  output  file  names.   PostScript  files
       "prefix_ss.ps"   and   "prefix_dp.ps"  are  produced  for  the  structure  and  dot  plot,
       respectively. Note, however, that once FASTA input was provided  all  following  sequences
       must be in FASTA format too.

       To  avoid  problems  with  certain  operating  systems and/or file systems the prefix will
       ALWAYS be sanitized! This step substitutes any  special  character  in  the  prefix  by  a
       filename  delimiter.  See  the  --filename-delim option to change the delimiting character
       according to your requirements.

       The program will continue to read new sequences until a  line  consisting  of  the  single
       character @ or an end of file (EOF) condition is encountered.

       -h, --help
              Print help and exit

       --detailed-help
              Print help, including all details and hidden options, and exit

       --full-help
              Print help, including hidden options, and exit

       -V, --version
              Print version and exit

   General Options:
              Command line options which alter the general behavior of this program

       -v, --verbose
              Be verbose.

              (default=off)

       -j, --jobs[=number]
              Split  batch  input  into  jobs  and  start  processing  in parallel using multiple
              threads. A value of 0 indicates to use as  many  parallel  threads  as  computation
              cores are available.

              (default=`0')

              Default  processing  of  input  data  is  performed  in  a serial fashion, i.e. one
              sequence at a time. Using this switch, a user can instead start the computation for
              many  sequences  in  the  input  in  parallel. RNAfold will create as many parallel
              computation slots as specified and assigns input sequences of the input file(s)  to
              the  available  slots.  Note,  that  this  increases memory consumption since input
              alignments have to be kept in memory until an empty compute slot is  available  and
              each running job requires its own dynamic programming matrices.

       --unordered
              Do  not  try  to  keep  output  in order with input while parallel processing is in
              place.

              (default=off)

              When parallel input processing (--jobs flag) is enabled, the order in  which  input
              is  processed  depends on the host machines job scheduler. Therefore, any output to
              stdout or files generated by this program will most likely not follow the order  of
              the  corresponding  input  data set. The default of RNAfold is to use a specialized
              data structure to still keep the results output  in  order  with  the  input  data.
              However,  this  comes  with  a  trade-off in terms of memory consumption, since all
              output must be kept in memory for as long as  no  chunks  of  consecutive,  ordered
              output  are  available.  By  setting  this flag, RNAfold will not buffer individual
              results but print them as soon as they have been computated.

       -i, --infile=<filename>
              Read a file instead of reading from stdin

              The default behavior of RNAfold is to read input from stdin  or  the  file(s)  that
              follow(s) the RNAfold command. Using this parameter the user can specify input file
              names where data is read from. Note, that any additional files supplied to  RNAfold
              are still processed as well.

       -o, --outfile[=<filename>]
              Print output to file instead of stdout

              This option may be used to write all output to output files rather than printing to
              stdout. The default filename is "RNAfold_output.fold" if no FASTA  header  precedes
              the  input sequences and the --auto-id feature is inactive. Otherwise, output files
              with the scheme "prefix.fold" are generated, where the "prefix" is taken  from  the
              sequence  id, e.g. the FASTA header. The user may specify a single output file name
              for all data generated from the input by supplying a filename as argument following
              immediately  after  this  parameter.  In case a file with the same filename already
              exists, any output of the program  will  be  appended  to  it.  Note:  Any  special
              characters  in the filename will be replaced by the filename delimiter, hence there
              is no way to pass an entire directory path through this option (yet). (See also the
              "--filename-delim" parameter)

       -t, --layout-type=INT
              Choose the layout algorithm.  (default=`1')

              Select  the  layout algorithm that computes the nucleotide coordinates.  Currently,
              the following algorithms are available:

              0: simple radial layout

              1: Naview layout (Bruccoleri et al. 1988)

              2: circular layout

              3: RNAturtle (Wiegreffe et al. 2018)

              4: RNApuzzler (Wiegreffe et al. 2018)

       --noPS Do not produce postscript drawing of the mfe structure.

              (default=off)

       --noDP Do  not  produce  dot-plot  postscript  file  containing   base   pair   or   stack
              probabilitities.

              (default=off)

              In  combination  with  the  -p  option,  this flag turns-off creation of individual
              dot-plot files. Consequently, computed base pair probability output is omitted  but
              centroid and MEA structure prediction is still performed.

       --noconv
              Do not automatically substitute nucleotide "T" with "U"

              (default=off)

       --auto-id
              Automatically generate an ID for each sequence.  (default=off)

              The  default  mode  of  RNAfold  is to automatically determine an ID from the input
              sequence data if the input file format allows to do that. Sequence IDs are  usually
              given  in  the  FASTA  header  of  input sequences. If this flag is active, RNAfold
              ignores any IDs retrieved from the input and automatically generates an ID for each
              sequence. This ID consists of a prefix and an increasing number. This flag can also
              be used to add a FASTA header to the output even if the input has none.

       --id-prefix=prefix
              Prefix for automatically generated IDs (as used in output file names)

              (default=`sequence')

              If this parameter is set, each sequence will be prefixed with the provided  string.
              Hence,  the output files will obey the following naming scheme: "prefix_xxxx_ss.ps"
              (secondary structure plot),  "prefix_xxxx_dp.ps"  (dot-plot),  "prefix_xxxx_dp2.ps"
              (stack  probabilities),  etc. where xxxx is the sequence number. Note: Setting this
              parameter implies --auto-id.

       --id-delim=delimiter
              Change the  delimiter  between  prefix  and  increasing  number  for  automatically
              generated IDs (as used in output file names)

              (default=`_')

              This parameter can be used to change the default delimiter "_" between

              the prefix string and the increasing number for automatically generated ID.

       --id-digits=INT
              Specify  the  number  of digits of the counter in automatically generated alignment
              IDs.

              (default=`4')

              When alignments IDs are automatically generated, they receive an increasing number,
              starting with 1. This number will always be left-padded by leading zeros, such that
              the number takes up a certain  width.  Using  this  parameter,  the  width  can  be
              specified  to  the  users  need.  We allow numbers in the range [1:18]. This option
              implies --auto-id.

       --id-start=LONG
              Specify the first number in automatically generated alignment IDs.

              (default=`1')

              When sequence IDs are automatically generated, they receive an  increasing  number,
              usually starting with 1. Using this parameter, the first number can be specified to
              the users requirements. Note: negative numbers are not allowed.  Note: Setting this
              parameter  implies  to  ignore  any  IDs  retrieved  from  the  input data, i.e. it
              activates the --auto-id flag.

       --filename-delim=delimiter
              Change the delimiting character that is used

              for sanitized filenames

              (default=`ID-delimiter')

              This parameter can be used to change the delimiting character used while sanitizing
              filenames,  i.e.  replacing  invalid  characters.  Note, that the default delimiter
              ALWAYS is the first character  of  the  "ID  delimiter"  as  supplied  through  the
              --id-delim  option.  If  the  delimiter is a whitespace character or empty, invalid
              characters will be simply removed rather than substituted. Currently, we regard the
              following  characters  as  illegal  for use in filenames: backslash '\', slash '/',
              question mark '?', percent sign '%', asterisk '*',  colon  ':',  pipe  symbol  '|',
              double quote '"', triangular brackets '<' and '>'.

       --filename-full
              Use full FASTA header to create filenames

              (default=off)

              This  parameter  can  be used to deactivate the default behavior of limiting output
              filenames to the first word of the sequence ID. Consider the following example:  An
              input  with  FASTA header ">NM_0001 Homo Sapiens some gene" usually produces output
              files with the prefix "NM_0001" without the additional data available in the  FASTA
              header,  e.g. "NM_0001_ss.ps" for secondary structure plots. With this flag set, no
              truncation of the output filenames is done, i.e. output filenames receive the  full
              FASTA  header  data  as  prefixes.  Note, however, that invalid characters (such as
              whitespace) will be substituted by a delimiting character or simply  removed,  (see
              also the parameter option --filename-delim).

   Structure Constraints:
              Command  line  options  to  interact with the structure constraints feature of this
              program

       --maxBPspan=INT
              Set the maximum base pair span

              (default=`-1')

       -C, --constraint[=<filename>] Calculate structures subject to constraints.
              (default=`')

              The program reads first the sequence, then a string containing constraints  on  the
              structure encoded with the symbols:

              . (no constraint for this base)

              | (the corresponding base has to be paired

              x (the base is unpaired)

              < (base i is paired with a base j>i)

              > (base i is paired with a base j<i)

              and matching brackets ( ) (base i pairs base j)

              With the exception of "|", constraints will disallow all pairs conflicting with the
              constraint. This is usually sufficient to enforce the constraint, but  occasionally
              a base may stay unpaired in spite of constraints. PF folding ignores constraints of
              type "|".

       --batch
              Use constraints for multiple sequences.  (default=off)

              Usually, constraints provided  from  input  file  only  apply  to  a  single  input
              sequence.  Therefore,  RNAfold  will  stop its computation and quit after the first
              input sequence was processed. Using this switch, RNAfold processes  multiple  input
              sequences and applies the same provided constraints to each of them.

       --canonicalBPonly
              Remove non-canonical base pairs from the structure constraint

              (default=off)

       --enforceConstraint
              Enforce base pairs given by round brackets ( ) in structure constraint

              (default=off)

       --shape=<filename>
              Use SHAPE reactivity data to guide structure predictions

       --shapeMethod=D|Z|W
              Select SHAPE reactivity data incorporation strategy.

              (default=`D')

              The  following methods can be used to convert SHAPE reactivities into pseudo energy
              contributions.

              'D': Convert by using a linear equation according to Deigan et al 2009.

              Derived pseudo energy terms will be applied for  every  nucleotide  involved  in  a
              stacked pair. This method is recognized by a capital 'D' in the provided parameter,
              i.e.: --shapeMethod="D" is the default setting. The slope 'm' and the intercept 'b'
              can  be  set  to  a  non-default value if necessary, otherwise m=1.8 and b=-0.6. To
              alter these parameters, e.g. m=1.9 and b=-0.7, use a parameter  string  like  this:
              --shapeMethod="Dm1.9b-0.7".  You  may  also  provide only one of the two parameters
              like: --shapeMethod="Dm1.9" or --shapeMethod="Db-0.7".

              'Z': Convert SHAPE reactivities to pseudo energies according to Zarringhalam

              et al 2012. SHAPE reactivities will be converted to pairing probabilities by  using
              linear  mapping.  Aberration  from  the  observed  pairing  probabilities  will  be
              penalized during the folding recursion. The magnitude of the penalties can affected
              by adjusting the factor beta (e.g. --shapeMethod="Zb0.8").

              'W': Apply a given vector of perturbation energies to unpaired nucleotides

              according  to  Washietl et al 2012. Perturbation vectors can be calculated by using
              RNApvmin.

       --shapeConversion=M|C|S|L|O
              Select method to convert SHAPE reactivities to

       pairing probabilities.
              (default=`O')

              This parameter is useful when dealing with the  SHAPE  incorporation  according  to
              Zarringhalam et al. The following methods can be used to convert SHAPE reactivities
              into the probability for a certain nucleotide to be unpaired.

              'M':  Use  linear  mapping  according  to  Zarringhalam  et   al.    'C':   Use   a
              cutoff-approach  to divide into paired and unpaired nucleotides (e.g. "C0.25") 'S':
              Skip the normalizing step since the input data already represents probabilities for
              being unpaired rather than raw reactivity values 'L': Use a linear model to convert
              the reactivity into a probability for being unpaired (e.g. "Ls0.68i0.2"  to  use  a
              slope  of  0.68 and an intercept of 0.2) 'O': Use a linear model to convert the log
              of the reactivity into a probability for being unpaired (e.g. "Os1.6i-2.29" to  use
              a slope of 1.6 and an intercept of -2.29)

       --motif=SEQUENCE,STRUCTURE,ENERGY
              Specify stabilizing effect of ligand binding to

              a particular sequence/structure motif.

              Some  ligands  binding  to  RNAs  require  and/or  induce  particular  sequence and
              structure motifs. For instance they bind to an  interior  loop,  or  small  hairpin
              loop.  If  for such cases a binding free energy is known, the binding and therefore
              stabilizing effect of the  ligand  can  be  included  in  the  folding  recursions.
              Interior  loop motifs are specified as concatenations of 5' and 3' motif, separated
              by an '&' character.

              Energy contributions must be specified in kcal/mol.

              See the manpage for an example usage of this option.

       --commands=<filename>
              Read additional commands from file

              Commands include hard and soft constraints, but also structure  motifs  in  hairpin
              and  interior  loops that need to be treeted differently. Furthermore, commands can
              be set for unstructured and structured domains.

   Algorithms:
              Select additional algorithms which should be included  in  the  calculations.   The
              Minimum  free  energy  (MFE)  and  a structure representative are calculated in any
              case.

       -p, --partfunc[=INT]
              Calculate the partition function and base pairing probability matrix.

              (default=`1')

              In addition to the MFE structure we print  a  coarse  representation  of  the  pair
              probabilities  in  form  of a pseudo bracket notation followed by the ensemble free
              energy. This notation makes use of the letters " . , | { } (  )  "  denoting  bases
              that  are  essentially unpaired, weakly paired, strongly paired without preference,
              weakly upstream (downstream) paired, or strongly up-  (down-)stream  paired  bases,
              respectively.  On  the  next  line  the centroid structure as derived from the pair
              probabilities together with its free energy and distance to the ensemble is  shown.
              Finally  it prints the frequency of the mfe structure, and the structural diversity
              (mean distance between the structures in the ensemble).   See  the  description  of
              pf_fold()  and  mean_bp_dist()  and  centroid()  in  the  RNAlib  documentation for
              details.  Note that unless you also specify -d2 or -d0, the partition function  and
              mfe  calculations will use a slightly different energy model. See the discussion of
              dangling end options below.

              An additionally passed value to this  option  changes  the  behavior  of  partition
              function  calculation:  -p0  Calculate  the  partition  function  but  not the pair
              probabilities, saving about 50% in runtime. This prints the  ensemble  free  energy
              -kT ln(Z).  -p2 Compute stack probabilities, i.e. the probability that a pair (i,j)
              and the immediately interior pair (i+1,j-1) are formed simultaneously  in  addition
              to  pair  probabilities.  A  second  postscript  dot  plot called "name_dp2.ps", or
              "dot2.ps" (if the sequence does not have a name), is produced  that  contains  pair
              probabilities in the upper right half and stack probabilities in the lower left.

       --MEA[=gamma]
              Calculate an MEA (maximum expected accuracy) structure, where the expected accuracy
              is computed from the  pair  probabilities:  each  base  pair  (i,j)  gets  a  score
              2*gamma*p_ij  and  the score of an unpaired base is given by the probability of not
              forming a pair.

              (default=`1.')

              The parameter gamma tunes  the  importance  of  correctly  predicted  pairs  versus
              unpaired bases. Thus, for small values of gamma the MEA structure will contain only
              pairs with very high probability.  Using --MEA implies -p for  computing  the  pair
              probabilities.

       -S, --pfScale=scaling factor
              In  the  calculation  of  the pf use scale*mfe as an estimate for the ensemble free
              energy (used to avoid overflows).

              The default is 1.07, useful values are 1.0 to 1.2.  Occasionally  needed  for  long
              sequences.   You  can  also  recompile the program to use double precision (see the
              README file).

       -c, --circ
              Assume a circular (instead of linear) RNA molecule.

              (default=off)

       --ImFeelingLucky
              Return exactly one stochastically backtracked structure

              (default=off)

              This function computes the partition function and  returns  exactly  one  secondary
              structure  stochastically  sampled  from the Boltzmann equilibrium according to its
              probability in the ensemble

       --bppmThreshold=<value>
              Set the threshold for base pair probabilities included in the postscript output

              (default=`1e-5')

              By setting the threshold the base pair  probabilities  that  are  included  in  the
              output  can  be varied. By default only those exceeding 1e-5 in probability will be
              shown as squares in the dot plot. Changing the threshold to any other value  allows
              for increase or decrease of data.

       -g, --gquad
              Incoorporate G-Quadruplex formation into the structure prediction algorithm.

              (default=off)

   Model Details:
       -T, --temp=DOUBLE
              Rescale energy parameters to a temperature of temp C. Default is 37C.

       -4, --noTetra
              Do not include special tabulated stabilizing energies for tri-, tetra- and hexaloop
              hairpins.

              (default=off)

              Mostly for testing.

       -d, --dangles=INT
              How to treat "dangling end" energies for bases adjacent to helices in free ends and
              multi-loops

              (default=`2')

              With -d1 only unpaired bases can participate in at most one dangling end.  With -d2
              this check is ignored, dangling energies will be added for the bases adjacent to  a
              helix on both sides in any case; this is the default for mfe and partition function
              folding (-p).   The  option  -d0  ignores  dangling  ends  altogether  (mostly  for
              debugging).   With  -d3 mfe folding will allow coaxial stacking of adjacent helices
              in multi-loops. At the moment the implementation will not allow coaxial stacking of
              the two interior pairs in a loop of degree 3 and works only for mfe folding.

              Note  that  with  -d1  and -d3 only the MFE computations will be using this setting
              while partition function uses -d2 setting,  i.e.  dangling  ends  will  be  treated
              differently.

       --noLP Produce structures without lonely pairs (helices of length 1).

              (default=off)

              For  partition  function  folding  this  only  disallows  pairs that can only occur
              isolated. Other pairs may still occasionally occur as helices of length 1.

       --noGU Do not allow GU pairs

              (default=off)

       --noClosingGU
              Do not allow GU pairs at the end of helices

              (default=off)

       -P, --paramFile=paramfile
              Read energy parameters from paramfile, instead of using the default parameter set.

              Different sets  of  energy  parameters  for  RNA  and  DNA  should  accompany  your
              distribution.   See  the  RNAlib documentation for details on the file format. When
              passing the placeholder file name "DNA", DNA parameters are loaded without the need
              to actually specify any input file.

       --nsp=STRING
              Allow other pairs in addition to the usual AU,GC,and GU pairs.

              Its  argument is a comma separated list of additionally allowed pairs. If the first
              character is a "-" then AB will imply that AB  and  BA  are  allowed  pairs.   e.g.
              RNAfold  -nsp  -GA   will  allow  GA  and  AG  pairs. Nonstandard pairs are given 0
              stacking energy.

       -e, --energyModel=INT
              Rarely used option to fold sequences from the artificial ABCD... alphabet, where  A
              pairs B, C-D etc.  Use the energy parameters for GC (-e 1) or AU (-e 2) pairs.

       --betaScale=DOUBLE
              Set the scaling of the Boltzmann factors (default=`1.')

              The  argument  provided  with  this  option  enables  to  scale  the  thermodynamic
              temperature used in the Boltzmann factors independently from the  temperature  used
              to  scale  the  individual  energy  contributions  of the loop types. The Boltzmann
              factors then become exp(-dG/(kT*betaScale)) where k is the Boltzmann  constant,  dG
              the free energy contribution of the state and T the absolute temperature.

REFERENCES

       If you use this program in your work you might want to cite:

       R.  Lorenz, S.H. Bernhart, C. Hoener zu Siederdissen, H. Tafer, C. Flamm, P.F. Stadler and
       I.L. Hofacker (2011), "ViennaRNA Package 2.0", Algorithms for Molecular Biology: 6:26

       I.L. Hofacker, W. Fontana, P.F. Stadler, S. Bonhoeffer, M.  Tacker,  P.  Schuster  (1994),
       "Fast  Folding and Comparison of RNA Secondary Structures", Monatshefte f. Chemie: 125, pp
       167-188

       R.  Lorenz,  I.L.  Hofacker,  P.F.  Stadler  (2016),  "RNA  folding  with  hard  and  soft
       constraints", Algorithms for Molecular Biology 11:1 pp 1-13

       M.  Zuker,  P.  Stiegler  (1981),  "Optimal  computer folding of large RNA sequences using
       thermodynamic and auxiliary information", Nucl Acid Res: 9, pp 133-148

       J.S.  McCaskill  (1990),  "The  equilibrium  partition  function  and  base  pair  binding
       probabilities for RNA secondary structures", Biopolymers: 29, pp 1105-1119

       I.L. Hofacker & P.F. Stadler (2006), "Memory Efficient Folding Algorithms for Circular RNA
       Secondary Structures", Bioinformatics

       A.F. Bompfuenewerer, R. Backofen, S.H. Bernhart, J. Hertel, I.L. Hofacker,  P.F.  Stadler,
       S.  Will  (2007),  "Variations  on {RNA} Folding and Alignment: Lessons from Benasque", J.
       Math. Biol.

       D. Adams (1979), "The hitchhiker's guide to the galaxy", Pan Books, London

       The calculation of mfe structures is based on  dynamic  programming  algorithm  originally
       developed  by  M. Zuker and P. Stiegler. The partition function algorithm is based on work
       by J.S. McCaskill.

       The energy parameters are taken from:

       D.H. Mathews, M.D. Disney, D. Matthew, J.L. Childs, S.J. Schroeder, J.  Susan,  M.  Zuker,
       D.H.  Turner  (2004),  "Incorporating  chemical  modification  constraints  into a dynamic
       programming algorithm for prediction of RNA secondary structure", Proc. Natl.  Acad.  Sci.
       USA: 101, pp 7287-7292

       D.H  Turner,  D.H.  Mathews  (2009),  "NNDB:  The  nearest neighbor parameter database for
       predicting stability of nucleic acid secondary structure", Nucleic Acids Research: 38,  pp
       280-282

EXAMPLES

       Single line sequence input and calculation of partition function and MEA structure

         $ RNAfold --MEA -d2 -p

       The   program   will   then   prompt  for  sequence  input.  Using  the  example  sequence
       "CGACGTAGATGCTAGCTGACTCGATGC" and pressing ENTER the output of the program will be similar
       to

         CGACGUAGAUGCUAGCUGACUCGAUGC
         (((.((((.......)).)))))....
          minimum free energy =  -1.90 kcal/mol
         (((.((((.......))},})))....
          free energy of ensemble =  -2.86 kcal/mol
         (((.(.((.......))..)))).... {  0.80 d=2.81}
         (((.((((.......))).)))).... { -1.90 MEA=22.32}
          frequency of mfe structure in ensemble 0.20997; ensemble diversity 4.19

       Here,  the  first  line  just  repeats  the sequence input. The second line contains a MFE
       structure in dot bracket notation followed by the minimum free  energy.  After  this,  the
       pairing  probabilities  for  each  nucleotide  are  shown in a pseudo dot-bracket notation
       followed by the free energy of ensemble. The next two lines show  the  centroid  structure
       with  its  free  energy and its distance to the ensemble as well as the MEA structure, its
       free energy and the  maximum  expected  accuracy,  respectively.  The  last  line  finally
       contains  the  frequency  of  the MFE representative in the complete ensemble of secondary
       structures and the ensemble diversity. For  further  details  about  the  calculation  and
       interpretation of the given output refer to the reference manual of RNAlib.

       Since  version  2.0  it  is also possible to provide FASTA file sequence input. Assume you
       have a file containing two sequences in FASTA format, e.g

         $ cat sequences.fa
         >seq1
         CGGCUCGCAACAGACCUAUUAGUUUUACGUAAUAUUUG
         GAACGAUCUAUAACACGACUUCACUCUU
         >seq2
         GAAUGACCCGAUAACCCCGUAAUAUUUGGAACGAUCUA
         UAACACGACUUCACUCUU

       In order to compute the MFE for the two sequences the user can use the following command

         $ RNAfold < sequences.fa

       which would result in an output like this

         >seq1
         CGGCUCGCAACAGACCUAUUAGUUUUACGUAAUAUUUGGAACGAUCUAUAACACGACUUCACUCUU
         .((.(((...((((..(((((........)))))))))...))).))................... ( -5.40)
         >seq2
         GAAUGACCCGAUAACCCCGUAAUAUUUGGAACGAUCUAUAACACGACUUCACUCUU
         .......((((..............))))........................... ( -2.00)

CONSTRAINT EXAMPLES

       Secondary structure constraints may be given in addition to the sequence information, too.
       Using  the  first  sequence of the previous example and restricting the nucleotides of the
       outermost helix to be unpaired, i.e. base pairs (2,47) and (3,46) the  input  file  should
       have the following form

         $ cat sequence_unpaired.fa
         >seq1
         CGGCUCGCAACAGACCUAUUAGUUUUACGUAAUAUUUG
         GAACGAUCUAUAACACGACUUCACUCUU
         .xx...................................
         .......xx...................

       Calling RNAfold with the structure constraint option -C it shows the following result

         $ RNAfold -C < sequence_unpaired.fa
         >seq1
         CGGCUCGCAACAGACCUAUUAGUUUUACGUAAUAUUUGGAACGAUCUAUAACACGACUUCACUCUU
         ....(((...((((..(((((........)))))))))...)))...................... ( -4.20)

       This represents the minimum free energy and a structure representative of the RNA sequence
       given that nucleotides 2,3,46 and 47 must not be involved in any base pair.   For  further
       information  about  constrained  folding  refer  to  the  details of the -C option and the
       reference manual of RNAlib.

       Since version 2.2 the ViennaRNA Package distinguishes hard and  soft  constraints.   As  a
       consequence,  structure predictions are easily amenable to a versatile set of constraints,
       such as maximal base pair span, incorporation of SHAPE  reactivity  data,  and  RNA-ligand
       binding to hairpin, or interior loop motifs.

       Restricting the maximal span of a base pair

       A  convenience  commandline  option  allows  you  to easily limit the distance (j - i + 1)
       between two nucleotides i and j that form a basepair. For instance a limit of 600nt can be
       accomplished using:

         $ RNAfold --maxBPspan 600

       Guide structure prediction with SHAPE reactivity data

       Use SHAPE reactivity data to guide secondary structure prediction:

         $ RNAfold --shape=reactivities.dat < sequence.fa

       where  the  file  reactivities.dat  is  a  two  column  text  file with sequence positions
       (1-based) and normalized reactivity values (usually between 0 and 2. Missing values may be
       left out, or assigned a negative score:

         $ cat reactivities.dat
         9    -999       # No reactivity information
         10   -999
         11   0.042816   # normalized SHAPE reactivity
         12   0          # also a valid SHAPE reactivity
         15   0.15027    # Missing data for pos. 13-14
         ...
         42   0.16201

       Note,  that  RNAfold will only process the first sequence in the input file, when provided
       with SHAPE reactivity data!

       Complex structure constraints and grammar extensions

       Structure constraints beyond those  that  can  be  expressed  with  a  pseudo-dot  bracket
       notation may be provided in a so-called command file:

         $ RNAfold --commands=constraints.txt < sequence.fa

       The  command file syntax is a generalization of constraints as used in UNAfold/mfold. Each
       line starts with a one or two letter command followed by command parameters. For structure
       constraints, this amounts to a single command character followed by three or four numbers.
       In addition, optional auxiliary modifier characters may be used to limit the constraint to
       specific loop types. For base pair specific constraints, we currently distinguish pairs in
       exterior loops (E), closing pairs of hairpin loops (H), closing (I) and enclosed (i) pairs
       of  interior  loops,  and  closing  (M)  and  enclosed  (m)  pairs  of  multibranch loops.
       Nucleotide-wise constraints may be limited to their loop context using  the  corresponding
       uppercase  characters.  The  default  is  to  apply  a  constraint  to all (A) loop types.
       Furthermore, pairing constraints for single nucleotides may be limited to upstream (U), or
       downstream (D) orientation. The command file specification is as follows:

         F i 0 k   [TYPE] [ORIENTATION] # Force nucleotides i...i+k-1 to be paired
         F i j k   [TYPE] # Force helix of size k starting with (i,j) to be formed
         P i 0 k   [TYPE] # Prohibit nucleotides i...i+k-1 to be paired
         P i j k   [TYPE] # Prohibit pairs (i,j),...,(i+k-1,j-k+1)
         P i-j k-l [TYPE] # Prohibit pairing between two ranges
         C i 0 k   [TYPE] # Nucleotides i,...,i+k-1 must appear in context TYPE
         C i j k          # Remove pairs conflicting with (i,j),...,(i+k-1,j-k+1)
         E i 0 k e        # Add pseudo-energy e to nucleotides i...i+k-1
         E i j k e        # Add pseudo-energy e to pairs (i,j),...,(i+k-1,j-k+1)
         UD m e    [LOOP] # Add ligand binding to unstructured domains with motif
                          # m and binding free energy e

                          # [LOOP]        = { E, H, I, M, A }
                          # [TYPE]        = [LOOP] + { i, m }
                          # [ORIENTATION] = { U, D }

       Again,  RNAfold  by  default  only processes the first sequence in the input sequence when
       provided with constraints in a command file. To apply the exact same constraints  to  each
       of the input sequences in a multi FASTA file, use the batch mode commandline option:

         $ RNAfold --constraint=constraints.txt --batch < sequences.fa

       Ligand binding contributions to specific hairpin/interior loop motifs

       A convenience function allows one to specify a hairping/interior loop motif where a ligand
       is binding with a particular binding free energy dG.  Here  is  an  example  that  adds  a
       theophylline  binding motif. Free energy contribution of this motif of dG=-9.22kcal/mol is
       derived from k_d=0.32umol/l, taken from Jenison et al.  1994. Although the structure motif
       consists of a symmetric interior loop of size 6, followed by a small helix of 3 basepairs,
       and a bulge of 3 nucleotides, the  entire  structure  can  still  be  represented  by  one
       interior  loop.   See the below mofif description where the '&' character splits the motif
       into a 5' and a 3' part. The first line gives the sequences motif, the second  line  shows
       the  actual structure motif of the aptamer pocket, and the third line is the interior loop
       motif that fully encapsulates the theophylline aptamer:

         GAUACCAG&CCCUUGGCAGC
         (...((((&)...)))...)
         (......(&).........)

       To use the above information in the folding recursions  of  RNAfold,  one  only  needs  to
       provide the motif itself, and binding free energy:

         $ RNAfold --motif="GAUACCAG&CCCUUGGCAGC,(...((((&)...)))...),-9.22" < sequences.fa

       Adding the --verbose option to the above call of RNAfold also prints the sequence position
       of each motif found in the MFE structure. In case interior-loop like motifs are  provided,
       two intervals are printed denoting the 5' and 3' part, respectively.

       Ligand binding contributions to unpaired segments of the RNA structure

       The  extension  of  the  RNA  folding grammar with unstructured domains allows for an easy
       incorporation of ligands that bind to unpaired stretches of an  RNA  structure.  To  model
       such interactions only two parameters are required: (i) a sequence motif in IUPAC notation
       that specifies where the ligand binds to, and (ii) a  binding  free  energy  that  can  be
       derived  from  the  association/dissociation  constant  of  the  ligand.   With  these two
       parameters in hand, the modification of RNAfold to  include  the  competition  of  regular
       intramolecular  base pairing and ligand interaction is as easy as writing a simple command
       file of the form:

         UD m e    [LOOP]

       where m is the motif string in upper-case IUPAC notation, and e the binding free energy in
       kcal/mol   and   optional  loop  type  restriction  [LOOP].  See  also  the  command  file
       specification as defined above.

       For instance, having a protein with a 4-nucleotide footprint  binding  'AAAA',  a  binding
       free  energy  e  =  -5.0  kcal/mol, and a binding restriction to exterior- and multibranch
       loops results in a command file:

         $ cat commands.txt
         UD AAAA -5.0  ME

       and the corresponding call  to  RNAfold  to  compute  MFE  and  equilibrium  probabilities
       becomes:

         $ RNAfold --commands=commands.txt -p < sequence.fa

       The resulting MFE plot will be annotated to display the binding site(s) of the ligand, and
       the base pair  probability  dot-plot  is  extended  to  include  the  probability  that  a
       particular nucleotide is bound by the ligand.

AUTHOR

       Ivo L Hofacker, Walter Fontana, Sebastian Bonhoeffer, Peter F Stadler, Ronny Lorenz

REPORTING BUGS

       If  in  doubt  our  program  is  right,  nature  is  at fault.  Comments should be sent to
       rna@tbi.univie.ac.at.