Provided by: seqprep_1.3.2-7_amd64 bug

NAME

       seqprep - merge paired end Illumina reads

       SeqPrep is a program to merge paired end Illumina reads that are overlapping into a single
       longer read. It may also just be used for its adapter trimming feature without  doing  any
       paired end overlap.

USAGE

       seqprep required args [options]

Required Arguments:

       -f <first read input fastq filename>
       -r <second read input fastq filename>
       -1 <first read output fastq filename>
       -2 <second read output fastq filename>

General Arguments (Optional):

       -3 <first read discarded fastq filename>
       -4 <second read discarded fastq filename>
       -h Display this help message and exit (also works with no args)
       -6 Input sequence is in phred+64 rather than phred+33 format, the output will still be phred+33
       -q <Quality score cutoff for mismatches to be counted in overlap; default = 13>
       -L <Minimum length of a trimmed or merged read to print it; default = 30>

Arguments for Adapter/Primer Trimming (Optional):

       -A <forward read primer/adapter sequence to trim as it would appear at the end of a read (recommend about 20bp of this)
            (should validate by grepping a file); default (genomic non-multiplexed adapter1) = AGATCGGAAGAGCGGTTCAG>
       -B <reverse read primer/adapter sequence to trim as it would appear at the end of a read (recommend about 20bp of this)
            (should validate by grepping a file); default (genomic non-multiplexed adapter2) = AGATCGGAAGAGCGTCGTGT>
       -O <minimum overall base pair overlap with adapter sequence to trim; default = 10>
       -M <maximum fraction of good quality mismatching bases for primer/adapter overlap; default = 0.020000>
       -N <minimum fraction of matching bases for primer/adapter overlap; default = 0.870000>
       -b <adapter alignment band-width; default = 50>
       -Q <adapter alignment gap-open; default = 8>
       -t <adapter alignment gap-extension; default = 2>
       -e <adapter alignment gap-end; default = 2>
       -Z <adapter alignment minimum local alignment score cutoff [roughly (2*num_hits) - (num_gaps*gap_open) - (num_gaps*gap_close) - (gap_len*gap_extend) - (2*num_mismatches)]; default = 26>
       -w <read alignment band-width; default = 50>
       -W <read alignment gap-open; default = 26>
       -p <read alignment gap-extension; default = 9>
       -P <read alignment gap-end; default = 5>
       -X <read alignment maximum fraction gap cutoff; default = 0.125000>

Optional Arguments for Merging:

       -y <maximum quality score in output ((phred 33) default = ´]´ )>
       -g <print overhang when adapters are present and stripped (use this if reads are different length)> - UNIMPLEMENTED
       -s <perform merging and output the merged reads to this file>
       -E <write pretty alignments to this file for visual Examination>
       -x <max number of pretty alignments to write (if -E provided); default = 10000>
       -o <minimum overall base pair overlap to merge two reads; default = 15>
       -m <maximum fraction of good quality mismatching bases to overlap reads; default = 0.020000>
       -n <minimum fraction of matching bases to overlap reads; default = 0.900000>

       NOTE 1: The output is always gziped compressed.

       NOTE  2: If the quality strings in the output contain characters less than asciii 33 on an
       ascii table (they look like lines from a binary file), try running again with  or  without
       the -6 option.

SETUP

       When  an  adapter sequence is present, that means that the two reads must overlap (in most
       cases) so they are forcefully merged. When reads do not have adapter sequence they must be
       treated  with  care when doing the merging, so a much more specific approach is taken. The
       default parameters were chosen with specificity in mind, so that  they  could  be  ran  on
       libraries where very few reads are expected to overlap. It is always safest though to save
       the overlapping procedure for libraries  where  you  have  some  prior  knowledge  that  a
       significant portion of the reads will have some overlap.

       Before  running  SeqPrep  make  sure  to  check that the program´s defaults are indeed the
       adapters you are looking for. Try copying the default forward adapter from this  file  and
       grep  it against your reads doing a word count, also try the same with the reverse adapter
       with grep. You should see some hits. You can also try using (and validating with grep)  -A
       GATCGGAAGAGCACACG  -B AGATCGGAAGAGCGTCGT as parameters. To find a list of Illumina adapter
       sequences you should write to Illumina tech support TechSupport@illumina.com (they do  not
       like people to share the list of sequences outside of their institution).

       Choose about 20bp of an adapter sequence where:

       1.  You see the most hits with grep.

       2.  When  you  run a command like zcat Lane2_0d_2.fastq.gz | head -n 1000000 |grep "INSERT
           ADAPTER HERE" | head you see the adapter sequence show up at the beginning  of  a  few
           reads.  Also  the  -A and -B arguments should be as they show up in your data, SeqPrep
           searches directly for these sequences without doing reverse complementing

       3.  Check the forward and reverse and make sure that you have roughly the same  number  of
           hits  via  a  command  to  count hits like: zcat Lane2_0d_2.fastq.gz | head -n 1000000
           |grep "INSERT ADAPTER HERE" | wc -l As an additional precaution,  the  program  checks
           for good read overlap once the adapters are trimmed. If the adapter is trimmed and the
           reads do not have a reasonable adapter overlap (you can modify this setting  with  -X)
           then the reads aren´t printed or merged.

       See  Test/README.md for some information on testing out other parameters. Test/SimTest has
       some particularly cool  test  data  which  you  can  use  to  check  out  sensitivity  and
       specificity  of  adapter  trimming using different parameters. The results of the test are
       displayed in results.html which uses  the  google  charts  API  so  that  the  points  are
       interactive and you can easily determine which settings made which points.

       LOW COMPLEXITY ALIGNMENTS

       My  current  strategy  to  deal  with ambiguous alignments to low complexity regions is as
       follows:

       I have some minimum requirements for an overlap to be accepted  After  the  first  one  is
       found  (ie  the one with the maximal overlap between the two sequences), if low complexity
       filtering is enabled, I keep searching if a second viable hit is found, I give up and  say
       that  it  is  not  a good idea to merge the two reads. I check for ambiguous alignments in
       read overlapping, but not in adapter trimming where the most conservative thing to  do  is
       strip the most aggressively aligned adapter (The closest to the beginning of the read).

       To accept an alignment I allow some fraction of mismatches (currently the floor of 0.06 of
       the alignment length for adapter and 0.02 of the alignment length  for  two  reads).  That
       means  that  in  most cases for overlapping two reads I don´t allow any mismatches between
       adjacent reads, but if there is a 50bp potential overlap with  1  mismatch  over  q20  for
       example,  I  allow  it.  Anything below 50 needs to be perfect other than with low quality
       bases.

       Since we ignore poor quality bases, we could have the  case  where  a  single  real  match
       followed  by  a long string of poor quality bases to the end of the read would result in a
       called overlap. That seemed like a bad idea. To get around that I require  that  at  least
       some fraction of the overlapping length be matches. Right now I have that parameter set at
       0.7 for adapter trimming and 0.75 for read merging, so for a case where only the  last  10
       bases overlap, at least 7 of those must be matches.

       Since  doing that many floating point multiplications seems like a bad idea, I just have a
       table that pre-calculates all of those min matches and  max  mismatch  numbers  for  every
       overlap length up to the maximum allowed read length.

       Finally  I  have  a  parameter you can set which specifies a minimum resulting read length
       after adapter trimming and/or merging so that ultra short trimmed reads aren´t output.

       Following are results from hand testing the  three  main  merge  cases.  Now  to  generate
       similar  output automatically just supply the -E readable_alignment.txt.gz argument to the
       program (the output is gzip compressed into the file name specified).

Sequence Merge No Adapter Present:

       QUER: NCCTGCTACTACCACCCGTTCCGTGCCTGGAGCCTGCATGTTGGGCAGATACGTGCTGCCACAGCCTGTCTCTGCTGGTGCCTGGGCCTC
                           ||  |||||||||||| || |  |||||||||||||||||||||||||||||||||
       SUBJ:                                   TGTGTGTTGGGCAGATGCGGGGGGCCACAGCCTGTCTCTGCTGGTGCCTGGGCCTCTCCTGTTCCTTGCCCACGTCTCCGTCTCCTGTTG
       RESU: NCCTGCTACTACCACCCGTTCCGTGCCTGGAGCCTGCATGTTGGGCAGATACGTGCTGCCACAGCCTGTCTCTGCTGGTGCCTGGGCCTCTCCTGTTCCTTGCCCACGTCTCCGTCTCCTGTTG
       Quality Merge:
       QUER: !223387787@@@CCC22C@@@@@@@@@@@@@@@@@@@@@@@@@@@@?@@89887:::::.2125@@:@@:::::@@@@@<<::8@@@@@
       SUBJ:                                   !!!!!!!!!!!!!!!!!!!!!!!!!!!@@@8DEGE@EDDBB2<BBE@EHBFE@EE>D8@DBE>BFIDH@IIEEIIBEIEIIGBIIGIFII
       RESU: !223387787@@@CCC22C@@@@@@@@@@@@@@@@@@@@@@@@@@@@?@@89887:::::.QPQLSSSSSSSSSSQSSSSSSSSSSSSSSD8@DBE>BFIDH@IIEEIIBEIEIIGBIIGIFII

Sequence Merge Adapter Present, Easy Peezy Mode (same lengths):

       SUBJ: NGATATGATTCCCAATCTAAGCAAACTGTCATGGAAAC
          |||||||||||||||||||||||||||||||||||||
       QUER: GGATATGATTCCCAATCTAAGCAAACTGTCATGGAAAC
       RESU: GGATATGATTCCCAATCTAAGCAAACTGTCATGGAAAC
       Quality Merge:
       SUBJ: !.-/.53444@@@@@@@@@@@@@@@@@@@@@@@@@@@@
       QUER: IHGIIIDIIHGEHIGHIFHIFIIIIHIIIIIIIIIHII
       RESU: ISSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS

Sequence merge Adapter but lengths differ:

       SUBJ: AATTGATGGGTGCCCACCCACGGGCCAGACAAAATCATCTGGCAAGCTGGATGCAGCCTACAAGCTGTAAGATTGGA
         |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
       QUER: AATTGATGGGTGCCCACCCACGGGCCAGACAAAATCATCTGGCAAGCTGGATGCAGCCTACAAGCTGTA
       RESU: AATTGATGGGTGCCCACCCACGGGCCAGACAAAATCATCTGGCAAGCTGGATGCAGCCTACAAGCTGTAAGATTGGA
       Quality Merge:
       SUBJ: =DEC??DDBD?4B=BEE@@@GB>GEE:DE8=2::6GDGBGEGDD<=;A?=AGGGG=5.=<BD?B?DDB>B4725:E>
       QUER: GDDBBFBGGFBHFIEDGGGBDGGG<GGDDG@IIIEIHDIHGIIIDDGDGDFDIFIHGIDEGGGDIIIGI
       RESU: SSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSB4725:E>

       If interested there is a website where I post my tests of different parameters for SeqPrep
       on  simulated  data.  There  are also a few comparison stats of different programs to trim
       adapters. The website can be accessed  here:  http://hgwdev.cse.ucsc.edu/~jstjohn/seqprep/
       where  the  pages  are  named result(date).html. The latest ones (as of when I have gotten
       around to edit this) can be found here:

       http://hgwdev.cse.ucsc.edu/~jstjohn/seqprep/results2011-09-15.html

       Note that although my program  is  more  sensitive  and  specific  than  fastq-clipper,  I
       optomized my default parameters based on this test. Results on real data may be different,
       although I believe my method takes advantage of a more realistic adapter model than  other
       software  does. For example, even though my program requires 10bp of adapter to be present
       at the end of a read to trim it off (by  default)  there  is  a  backup  adapter  trimming
       function  that  trimms  based  on  strong and unambiguous read overlap. Because of this my
       program can trim the adapter even if it is only present in the last few bases of the read.

       Also note that fastq-mcf appears to do a little better at sensitivity (0.992 vs 0.985)  at
       a very large cost to specificity (0.497 vs 0.994).

AUTHOR

       ○   All content by John St. John

       ○   Manpage edited for Debian by Tim Booth