Provided by: libmce-perl_1.876-1_all bug

NAME

       MCE::Relay - Extends Many-Core Engine with relay capabilities

VERSION

       This document describes MCE::Relay version 1.876

SYNOPSIS

        use MCE::Flow;

        my $file = shift || \*STDIN;

        ## Line Count #######################################

        mce_flow_f {
           max_workers => 4,
           use_slurpio => 1,
           init_relay  => 0,
        },
        sub {
           my ($mce, $slurp_ref, $chunk_id) = @_;
           my $line_count = ($$slurp_ref =~ tr/\n//);

           ## Receive and pass on updated information.
           my $lines_read = MCE::relay { $_ += $line_count };

        }, $file;

        my $total_lines = MCE->relay_final;

        print {*STDERR} "$total_lines\n";

        ## Orderly Action ###################################

        $| = 1; # Important, must flush output immediately.

        mce_flow_f {
           max_workers => 2,
           use_slurpio => 1,
           init_relay  => 0,
        },
        sub {
           my ($mce, $slurp_ref, $chunk_id) = @_;

           ## The relay value is relayed and remains 0.
           ## Writes to STDOUT orderly.

           MCE->relay_lock;
           print $$slurp_ref;
           MCE->relay_unlock;

        }, $file;

DESCRIPTION

       This module enables workers to receive and pass on information orderly with zero
       involvement by the manager process while running. The module is loaded automatically when
       MCE option "init_relay" is specified.

       All workers (belonging to task_id 0) must participate when relaying data.

       Relaying is not meant for passing big data. The last worker will stall if exceeding the
       buffer size for the socket. Not exceeding 16 KiB - 7 is safe across all platforms.

API DOCUMENTATION

       MCE::relay { code }
       MCE->relay ( sub { code } )
       $mce->relay ( sub { code } )

       Relay is enabled by specifying the init_relay option which takes a hash or array
       reference, or a scalar value. Relaying is orderly and driven by chunk_id when processing
       data, otherwise task_wid. Omitting the code block (e.g. MCE::relay) relays forward.

       Below, relaying multiple values via a HASH reference.

        use MCE::Flow max_workers => 4;

        mce_flow {
           init_relay => { p => 0, e => 0 },
        },
        sub {
           my $wid = MCE->wid;

           ## do work
           my $pass = $wid % 3;
           my $errs = $wid % 2;

           ## relay
           my %last_rpt = MCE::relay { $_->{p} += $pass; $_->{e} += $errs };

           MCE->print("$wid: passed $pass, errors $errs\n");

           return;
        };

        my %results = MCE->relay_final;

        print "   passed $results{p}, errors $results{e} final\n\n";

        -- Output

        1: passed 1, errors 1
        2: passed 2, errors 0
        3: passed 0, errors 1
        4: passed 1, errors 0
           passed 4, errors 2 final

       Or multiple values via an ARRAY reference.

        use MCE::Flow max_workers => 4;

        mce_flow {
           init_relay => [ 0, 0 ],
        },
        sub {
           my $wid = MCE->wid;

           ## do work
           my $pass = $wid % 3;
           my $errs = $wid % 2;

           ## relay
           my @last_rpt = MCE::relay { $_->[0] += $pass; $_->[1] += $errs };

           MCE->print("$wid: passed $pass, errors $errs\n");

           return;
        };

        my ($pass, $errs) = MCE->relay_final;

        print "   passed $pass, errors $errs final\n\n";

        -- Output

        1: passed 1, errors 1
        2: passed 2, errors 0
        3: passed 0, errors 1
        4: passed 1, errors 0
           passed 4, errors 2 final

       Or simply a scalar value.

        use MCE::Flow max_workers => 4;

        mce_flow {
           init_relay => 0,
        },
        sub {
           my $wid = MCE->wid;

           ## do work
           my $bytes_read = 1000 + ((MCE->wid % 3) * 3);

           ## relay
           my $last_offset = MCE::relay { $_ += $bytes_read };

           ## output
           MCE->print("$wid: $bytes_read\n");

           return;
        };

        my $total = MCE->relay_final;

        print "   $total size\n\n";

        -- Output

        1: 1003
        2: 1006
        3: 1000
        4: 1003
           4012 size

       MCE->relay_final ( void )
       $mce->relay_final ( void )

       Call this method to obtain the final relay value(s) after running. See included example
       findnull.pl for another use case.

        use MCE max_workers => 4;

        my $mce = MCE->new(
           init_relay => [ 0, 100 ],       ## initial values (two counters)

           user_func => sub {
              my ($mce) = @_;

              ## do work
              my ($acc1, $acc2) = (10, 20);

              ## relay to next worker
              MCE::relay { $_->[0] += $acc1; $_->[1] += $acc2 };

              return;
           }
        )->run;

        my ($cnt1, $cnt2) = $mce->relay_final;

        print "$cnt1 : $cnt2\n";

        -- Output

        40 : 180

       MCE->relay_recv ( void )
       $mce->relay_recv ( void )

       Call this method to obtain the next relay value before relaying. This allows serial-code
       to be processed orderly between workers. The following is a parallel demonstration for the
       fasta-benchmark on the web.

        # perl fasta.pl 25000000

        # The Computer Language Benchmarks game
        # http://benchmarksgame.alioth.debian.org/
        #
        # contributed by Barry Walsh
        # port of fasta.rb #6
        #
        # MCE::Flow version by Mario Roy
        # requires MCE 1.807+
        # requires MCE::Shared 1.806+

        use strict;
        use warnings;
        use feature 'say';

        use MCE::Flow;
        use MCE::Shared;
        use MCE::Candy;

        use constant IM => 139968;
        use constant IA => 3877;
        use constant IC => 29573;

        my $LAST = MCE::Shared->scalar( 42 );

        my $alu =
           'GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG' .
           'GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA' .
           'CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT' .
           'ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA' .
           'GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG' .
           'AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC' .
           'AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA';

        my $iub = [
           [ 'a', 0.27 ], [ 'c', 0.12 ], [ 'g', 0.12 ],
           [ 't', 0.27 ], [ 'B', 0.02 ], [ 'D', 0.02 ],
           [ 'H', 0.02 ], [ 'K', 0.02 ], [ 'M', 0.02 ],
           [ 'N', 0.02 ], [ 'R', 0.02 ], [ 'S', 0.02 ],
           [ 'V', 0.02 ], [ 'W', 0.02 ], [ 'Y', 0.02 ]
        ];

        my $homosapiens = [
           [ 'a', 0.3029549426680 ],
           [ 'c', 0.1979883004921 ],
           [ 'g', 0.1975473066391 ],
           [ 't', 0.3015094502008 ]
        ];

        sub make_repeat_fasta {
           my ( $src, $n ) = @_;
           my $width = qr/(.{1,60})/;
           my $l     = length $src;
           my $s     = $src x ( ($n / $l) + 1 );
           substr( $s, $n, $l ) = '';

           while ( $s =~ m/$width/g ) { say $1 }
        }

        sub make_random_fasta {
           my ( $table, $n ) = @_;
           my $rand   = undef;
           my $width  = 60;
           my $prob   = 0.0;
           my $output = '';
           my ( $c1, $c2, $last );

           $_->[1] = ( $prob += $_->[1] ) for @$table;

           $c1  = '$rand = ( $last = ( $last * IA + IC ) % IM ) / IM;';
           $c1 .= "\$output .= '$_->[0]', next if $_->[1] > \$rand;\n" for @$table;

           my $seq = MCE::Shared->sequence(
              { chunk_size => 2000, bounds_only => 1 },
              1, $n / $width
           );

           my $code1 = q{
              while ( 1 ) {
                 # --------------------------------------------
                 # Process code orderly between workers.
                 # --------------------------------------------

                 my $chunk_id = MCE->relay_recv;
                 my ( $begin, $end ) = $seq->next;

                 MCE->relay, last if ( !defined $begin );

                 my $last = $LAST->get;
                 my $temp = $last;

                 # Pre-compute $LAST value for the next worker
                 for ( 1 .. ( $end - $begin + 1 ) * $width ) {
                    $temp = ( $temp * IA + IC ) % IM;
                 }

                 $LAST->set( $temp );

                 # Increment chunk_id value
                 MCE->relay( sub { $_ += 1 } );

                 # --------------------------------------------
                 # Also run code in parallel between workers.
                 # --------------------------------------------

                 for ( $begin .. $end ) {
                    for ( 1 .. $width ) { !C! }
                    $output .= "\n";
                 }

                 # --------------------------------------------
                 # Display orderly.
                 # --------------------------------------------

                 MCE->gather( $chunk_id, $output );

                 $output = '';
              }
           };

           $code1 =~ s/!C!/$c1/g;

           MCE::Flow->init(
              max_workers => 4, ## MCE::Util->get_ncpu || 4,
              gather      => MCE::Candy::out_iter_fh( \*STDOUT ),
              init_relay  => 1,
              use_threads => 0,
           );

           MCE::Flow->run( sub { eval $code1 } );
           MCE::Flow->finish;

           $last = $LAST->get;

           $c2  = '$rand = ( $last = ( $last * IA + IC ) % IM ) / IM;';
           $c2 .= "print('$_->[0]'), next if $_->[1] > \$rand;\n" for @$table;

           my $code2 = q{
              if ( $n % $width != 0 ) {
                 for ( 1 .. $n % $width ) { !C! }
                 print "\n";
              }
           };

           $code2 =~ s/!C!/$c2/g;
           eval $code2;

           $LAST->set( $last );
        }

        my $n = $ARGV[0] || 27;

        say ">ONE Homo sapiens alu";
        make_repeat_fasta( $alu, $n * 2 );

        say ">TWO IUB ambiguity codes";
        make_random_fasta( $iub, $n * 3 );

        say ">THREE Homo sapiens frequency";
        make_random_fasta( $homosapiens, $n * 5 );

       MCE->relay_lock ( void )
       MCE->relay_unlock ( void )
       $mce->relay_lock ( void )
       $mce->relay_unlock ( void )

       The "relay_lock" and "relay_unlock" methods, added to MCE 1.807, are aliases for
       "relay_recv" and "relay" respectively. Together, they allow one to perform an exclusive
       action prior to actual relaying of data.

       Relaying is driven by "chunk_id" or "task_wid" when not processing input, as seen here.

        MCE->new(
           max_workers => 8,
           init_relay => 0,
           user_func => sub {
              MCE->relay_lock;
              MCE->say("wid: ", MCE->task_wid);
              MCE->relay_unlock( sub {
                 $_ += 2;
              });
           }
        )->run;

        MCE->say("sum: ", MCE->relay_final);

        __END__

        wid: 1
        wid: 2
        wid: 3
        wid: 4
        wid: 5
        wid: 6
        wid: 7
        wid: 8
        sum: 16

       Described above, "relay" takes a code block and combines "relay_lock" and "relay_unlock"
       into a single call. To make this more interesting, I define "init_relay" to a hash
       containing two key-value pairs.

        MCE->new(
           max_workers => 8,
           init_relay => { count => 0, total => 0 },
           user_func => sub {
              MCE->relay_lock;
              MCE->say("wid: ", MCE->task_wid);
              MCE->relay_unlock( sub {
                 $_->{count} += 1;
                 $_->{total} += 2;
              });
           }
        )->run;

        my %results = MCE->relay_final;

        MCE->say("count: ", $results{count});
        MCE->say("total: ", $results{total});

        __END__

        wid: 1
        wid: 2
        wid: 3
        wid: 4
        wid: 5
        wid: 6
        wid: 7
        wid: 8
        count: 8
        total: 16

       Below, "user_func" is taken from the "cat.pl" MCE example. Incrementing the count is done
       only when the "-n" switch is passed to the script.  Otherwise, output is displaced orderly
       and not necessary to update the $_ value if exclusive locking is all you need.

        user_func => sub {
           my ($mce, $chunk_ref, $chunk_id) = @_;

           if ($n_flag) {
              ## Relays the total lines read.

              my $output = ''; my $line_count = ($$chunk_ref =~ tr/\n//);
              my $lines_read = MCE::relay { $_ += $line_count };

              open my $fh, '<', $chunk_ref;
              $output .= sprintf "%6d\t%s", ++$lines_read, $_ while (<$fh>);
              close $fh;

              $output .= ":$chunk_id";
              MCE->do('display_chunk', $output);
           }
           else {
              ## The following is another way to have ordered output. Workers
              ## write directly to STDOUT exclusively without any involvement
              ## from the manager process. The statement(s) between relay_lock
              ## and relay_unlock run serially and most important orderly.

              MCE->relay_lock;      # alias for MCE->relay_recv
              print $$chunk_ref;    # ensure $| = 1 in script
              MCE->relay_unlock;    # alias for MCE->relay
           }

           return;
        }

       The following is a variant of the fasta-benchmark demonstration shown above.  Here,
       workers write exclusively and orderly to "STDOUT".

        # perl fasta.pl 25000000

        # The Computer Language Benchmarks game
        # http://benchmarksgame.alioth.debian.org/
        #
        # contributed by Barry Walsh
        # port of fasta.rb #6
        #
        # MCE::Flow version by Mario Roy
        # requires MCE 1.807+
        # requires MCE::Shared 1.806+

        use strict;
        use warnings;
        use feature 'say';

        use MCE::Flow;
        use MCE::Shared;

        use constant IM => 139968;
        use constant IA => 3877;
        use constant IC => 29573;

        my $LAST = MCE::Shared->scalar( 42 );

        my $alu =
           'GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG' .
           'GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA' .
           'CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT' .
           'ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA' .
           'GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG' .
           'AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC' .
           'AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA';

        my $iub = [
           [ 'a', 0.27 ], [ 'c', 0.12 ], [ 'g', 0.12 ],
           [ 't', 0.27 ], [ 'B', 0.02 ], [ 'D', 0.02 ],
           [ 'H', 0.02 ], [ 'K', 0.02 ], [ 'M', 0.02 ],
           [ 'N', 0.02 ], [ 'R', 0.02 ], [ 'S', 0.02 ],
           [ 'V', 0.02 ], [ 'W', 0.02 ], [ 'Y', 0.02 ]
        ];

        my $homosapiens = [
           [ 'a', 0.3029549426680 ],
           [ 'c', 0.1979883004921 ],
           [ 'g', 0.1975473066391 ],
           [ 't', 0.3015094502008 ]
        ];

        sub make_repeat_fasta {
           my ( $src, $n ) = @_;
           my $width = qr/(.{1,60})/;
           my $l     = length $src;
           my $s     = $src x ( ($n / $l) + 1 );
           substr( $s, $n, $l ) = '';

           while ( $s =~ m/$width/g ) { say $1 }
        }

        sub make_random_fasta {
           my ( $table, $n ) = @_;
           my $rand   = undef;
           my $width  = 60;
           my $prob   = 0.0;
           my $output = '';
           my ( $c1, $c2, $last );

           $_->[1] = ( $prob += $_->[1] ) for @$table;

           $c1  = '$rand = ( $last = ( $last * IA + IC ) % IM ) / IM;';
           $c1 .= "\$output .= '$_->[0]', next if $_->[1] > \$rand;\n" for @$table;

           my $seq = MCE::Shared->sequence(
              { chunk_size => 2000, bounds_only => 1 },
              1, $n / $width
           );

           my $code1 = q{
              $| = 1; # Important, must flush output immediately.

              while ( 1 ) {
                 # --------------------------------------------
                 # Process code orderly between workers.
                 # --------------------------------------------

                 MCE->relay_lock;

                 my ( $begin, $end ) = $seq->next;
                 print( $output ), $output = '' if ( length $output );

                 MCE->relay_unlock, last if ( !defined $begin );

                 my $last = $LAST->get;
                 my $temp = $last;

                 # Pre-compute $LAST value for the next worker
                 for ( 1 .. ( $end - $begin + 1 ) * $width ) {
                    $temp = ( $temp * IA + IC ) % IM;
                 }

                 $LAST->set( $temp );

                 MCE->relay_unlock;

                 # --------------------------------------------
                 # Also run code in parallel.
                 # --------------------------------------------

                 for ( $begin .. $end ) {
                    for ( 1 .. $width ) { !C! }
                    $output .= "\n";
                 }
              }
           };

           $code1 =~ s/!C!/$c1/g;

           MCE::Flow->init(
              max_workers => 4, ## MCE::Util->get_ncpu || 4,
              init_relay  => 0,
              use_threads => 0,
           );

           MCE::Flow->run( sub { eval $code1 } );
           MCE::Flow->finish;

           $last = $LAST->get;

           $c2  = '$rand = ( $last = ( $last * IA + IC ) % IM ) / IM;';
           $c2 .= "print('$_->[0]'), next if $_->[1] > \$rand;\n" for @$table;

           my $code2 = q{
              if ( $n % $width != 0 ) {
                 for ( 1 .. $n % $width ) { !C! }
                 print "\n";
              }
           };

           $code2 =~ s/!C!/$c2/g;
           eval $code2;

           $LAST->set( $last );
        }

        my $n = $ARGV[0] || 27;

        say ">ONE Homo sapiens alu";
        make_repeat_fasta( $alu, $n * 2 );

        say ">TWO IUB ambiguity codes";
        make_random_fasta( $iub, $n * 3 );

        say ">THREE Homo sapiens frequency";
        make_random_fasta( $homosapiens, $n * 5 );

GATHER AND RELAY DEMONSTRATIONS

       I received a request from John Martel to process a large flat file and expand each record
       to many records based on splitting out items in field 4 delimited by semicolons. Each row
       in the output is given a unique ID starting with one while preserving output order.

       Input File, possibly larger than 500 GiB in size
           foo|field2|field3|item1;item2;item3;item4;itemN|field5|field6|field7
           bar|field2|field3|item1;item2;item3;item4;itemN|field5|field6|field7
           baz|field2|field3|item1;item2;item3;item4;itemN|field5|field6|field7
           ...

       Output File
           000000000000001|item1|foo|field2|field3|field5|field6|field7
           000000000000002|item2|foo|field2|field3|field5|field6|field7
           000000000000003|item3|foo|field2|field3|field5|field6|field7
           000000000000004|item4|foo|field2|field3|field5|field6|field7
           000000000000005|itemN|foo|field2|field3|field5|field6|field7
           000000000000006|item1|bar|field2|field3|field5|field6|field7
           000000000000007|item2|bar|field2|field3|field5|field6|field7
           000000000000008|item3|bar|field2|field3|field5|field6|field7
           000000000000009|item4|bar|field2|field3|field5|field6|field7
           000000000000010|itemN|bar|field2|field3|field5|field6|field7
           000000000000011|item1|baz|field2|field3|field5|field6|field7
           000000000000012|item2|baz|field2|field3|field5|field6|field7
           000000000000013|item3|baz|field2|field3|field5|field6|field7
           000000000000014|item4|baz|field2|field3|field5|field6|field7
           000000000000015|itemN|baz|field2|field3|field5|field6|field7
           ...

       Example One

       This example configures a custom function for preserving output order.  Unfortunately, the
       sprintf function alone involves extra CPU time causing the manager process to fall behind.
       Thus, workers may idle while waiting for the manager process to respond to the gather
       request.

        use strict;
        use warnings;

        use MCE::Loop;

        my $infile  = shift or die "Usage: $0 infile\n";
        my $newfile = 'output.dat';

        open my $fh_out, '>', $newfile or die "open error $newfile: $!\n";

        sub preserve_order {
            my ($fh) = @_;
            my ($order_id, $start_idx, $idx, %tmp) = (1, 1);

            return sub {
                my ($chunk_id, $aref) = @_;
                $tmp{ $chunk_id } = $aref;

                while ( my $aref = delete $tmp{ $order_id } ) {
                    foreach my $line ( @{ $aref } ) {
                        $idx = sprintf "%015d", $start_idx++;
                        print $fh $idx, $line;
                    }
                    $order_id++;
                }
            }
        }

        MCE::Loop->init(
            chunk_size => 'auto', max_workers => 3,
            gather => preserve_order($fh_out)
        );

        mce_loop_f {
            my ($mce, $chunk_ref, $chunk_id) = @_;
            my @buf;

            foreach my $line (@{ $chunk_ref }) {
                $line =~ s/\r//g; chomp $line;

                my ($f1,$f2,$f3,$items,$f5,$f6,$f7) = split /\|/, $line;
                my @items_array = split /;/, $items;

                foreach my $item (@items_array) {
                    push @buf, "|$item|$f1|$f2|$f3|$f5|$f6|$f7\n";
                }
            }

            MCE->gather($chunk_id, \@buf);

        } $infile;

        MCE::Loop->finish();
        close $fh_out;

       Example Two

       In this example, workers obtain the current ID value and increment/relay for the next
       worker, ordered by chunk ID behind the scene. Workers call sprintf in parallel, allowing
       the manager process (out_iter_fh) to accommodate up to 32 workers and not fall behind.

       Relay accounts for the worker handling the next chunk_id value. Therefore, do not call
       relay more than once per chunk. Doing so will cause IPC to stall.

        use strict;
        use warnings;

        use MCE::Loop;
        use MCE::Candy;

        my $infile  = shift or die "Usage: $0 infile\n";
        my $newfile = 'output.dat';

        open my $fh_out, '>', $newfile or die "open error $newfile: $!\n";

        MCE::Loop->init(
            chunk_size => 'auto', max_workers => 8,
            gather => MCE::Candy::out_iter_fh($fh_out),
            init_relay => 1
        );

        mce_loop_f {
            my ($mce, $chunk_ref, $chunk_id) = @_;
            my @lines;

            foreach my $line (@{ $chunk_ref }) {
                $line =~ s/\r//g; chomp $line;

                my ($f1,$f2,$f3,$items,$f5,$f6,$f7) = split /\|/, $line;
                my @items_array = split /;/, $items;

                foreach my $item (@items_array) {
                    push @lines, "$item|$f1|$f2|$f3|$f5|$f6|$f7\n";
                }
            }

            my $idx = MCE::relay { $_ += scalar @lines };
            my $buf = '';

            foreach my $line ( @lines ) {
                $buf .= sprintf "%015d|%s", $idx++, $line
            }

            MCE->gather($chunk_id, $buf);

        } $infile;

        MCE::Loop->finish();
        close $fh_out;

INDEX

       MCE, MCE::Core

AUTHOR

       Mario E. Roy, <marioeroy AT gmail DOT com>