Provided by: vienna-rna_2.4.17+dfsg-2build2_amd64 
NAME
RNAup - manual page for RNAup 2.4.17
SYNOPSIS
RNAup [OPTION]...
DESCRIPTION
RNAup 2.4.17
Calculate the thermodynamics of RNA-RNA interactions
RNAup calculates the thermodynamics of RNA-RNA interactions, by decomposing the binding
into two stages. (1) First the probability that a potential binding sites remains unpaired
(equivalent to the free energy needed to open the site) is computed. (2) Then this
accessibility is combined with the interaction energy to obtain the total binding energy.
All calculations are done by computing partition functions over all possible
conformations.
RNAup provides two different modes: By default RNAup computes accessibilities, in terms of
the free energies needed to open a region (default length 4). It prints the region of
highest accessibility and its opening energy to stdout, opening energies for all other
regions are written to a file.
In interaction mode the interaction between two RNAs is calculated. It is invoked if the
input consists of two sequences concatenated with an "&", or if the options -X[pf] or -b
are given. Unless the -b option is specified RNAup assumes that the longer RNA is a
structured target sequence while the shorter one is an unstructured small RNA.
Additionally, for every position along the target sequence we write the best free energy
of binding for an interaction that includes this position to the the output file. Output
to stdout consists of the location and free energy, dG, for the optimal region of
interaction. The binding energy dG is also split into its components the interaction
energy dGint and the opening energy dGu_l (and possibly dGu_s for the shorter sequence).
In addition we print the optimal interaction structure as computed by RNAduplex for this
region. Note that it can happen that the RNAduplex computed optimal interaction does not
coincide with the optimal RNAup region. If the two predictions don't match the structure
string is replaced by a run of "." and a message is written to stderr.
Each sequence should be in 5' to 3' direction. If the sequence is preceded by a line of
the form
> name
the output file "name_ux_up.out" is produced, where the "x" in "ux" is the value set by
the -u option. Otherwise the file name defaults to RNA_ux_up.out. The output is
concatenated if a file with the same name exists.
RNA sequences are read from stdin as strings of characters. White space and newline within
a sequence cause an error! Newline is used to separate sequences. The program will
continue to read new sequences until a line consisting of the single character @ or an end
of file condition is encountered.
-h, --help
Print help and exit
--detailed-help
Print help, including all details and hidden options, and exit
--full-help
Print help, including hidden options, and exit
-V, --version
Print version and exit
General Options:
Below are command line options which alter the general behavior of this program
-C, --constraint
Apply structural constraint(s) during prediction. (default=off)
The program first reads the sequence(s), then a dot-bracket like string containing
constraints on the structure. The following symbols are recognized:
'.' ... no constraint for this base
'x' ... the base is unpaired
'<' ... the base pairs downstream, i.e. i is paired with j > i
'>' ... the base pairs upstream, i.e. i is paired with j < i
'()' ... base i pairs with base j
'|' ... the corresponding base has to be paired intermolecularily (only for
interaction mode)
-o, --no_output_file
Do not produce an output file. (default=off)
--no_header
Do not produce a header with the command line parameters used in the outputfile.
(default=off)
--noconv
Do not automatically substitude nucleotide "T" with "U". (default=off)
Calculations of opening energies:
-u, --ulength=length
Specify the length of the unstructured region in the output. (default=`4')
The probability of being unpaired is plotted on the right border of the unpaired
region. You can specify up to 20 different length values: use "-" to specify a
range of continuous values (e.g. -u 4-8) or specify a list of comma separated
values (e.g. -u 4,8,15).
-c, --contributions=SHIME
Specify the contributions listed in the output. (default=`S')
By default only the full probability of being unpaired is plotted. The -c option
allows one to get the different contributions (c) to the probability of being
unpaired: The full probability of being unpaired ("S" is the sum of the probability
of being unpaired in the exterior loop ("E"), within a hairpin loop ("H"), within
an interior loop ("I") and within a multiloop ("M"). Any combination of these
letters may be given.
Calculations of RNA-RNA interactions:
-w, --window=INT
Set the maximal length of the region of interaction. (default=`25')
-b, --include_both
Include the probability of unpaired regions in both (b) RNAs. (default=off)
By default only the probability of being unpaired in the longer RNA (target) is
used.
-5, --extend5=INT
Extend the region of interaction in the target to some residues on the 5' side.
The underlying assumption is that it is favorable for an interaction if not only
the direct region of contact is unpaired but also a few residues 5'
-3, --extend3=INT
Extend the region of interaction in the target to some residues on the 3' side.
The underlying assumption is that it is favorable for an interaction if not only
the direct region of contact is unpaired but also a few residues 3'
--interaction_pairwise
Activate pairwise interaction mode. (default=off)
The first sequence interacts with the 2nd, the third with the 4th etc. If
activated, two interacting sequences may be given in a single line separated by "&"
or each sequence may be given on an extra line.
--interaction_first
Activate interaction mode using first sequence only. (default=off)
The interaction of each sequence with the first one is calculated (e.g.
interaction of one mRNA with many small RNAs). Each sequence has to be given on an
extra line
Model Details:
-S, --pfScale=DOUBLE
Set scaling factor for Boltzmann factors to prevent under/overflows.
In the calculation of the pf use scale*mfe as an estimate for the ensemble free
energy (used to avoid overflows). The default is 1.07, useful values are 1.0 to
1.2. Occasionally needed for long sequences. You can also recompile the program to
use double precision (see the README file).
-T, --temp=DOUBLE
Rescale energy parameters to a temperature in degrees centigrade. (default=`37.0')
-4, --noTetra
Do not include special tabulated stabilizing energies for tri-, tetra- and hexaloop
hairpins. (default=off)
Mostly for testing.
-d, --dangles=INT
Specify "dangling end" model for bases adjacent to helices in free ends and
multi-loops. (default=`2')
With -d2 dangling energies will be added for the bases adjacent to a helix on both
sides in any case.
The option -d0 ignores dangling ends altogether (mostly for debugging).
--noLP Produce structures without lonely pairs (helices of length 1). (default=off)
For partition function folding this only disallows pairs that can only occur
isolated. Other pairs may still occasionally occur as helices of length 1.
--noGU Do not allow GU pairs. (default=off)
--noClosingGU
Do not allow GU pairs at the end of helices. (default=off)
-P, --paramFile=paramfile
Read energy parameters from paramfile, instead of using the default parameter set.
Different sets of energy parameters for RNA and DNA should accompany your
distribution. See the RNAlib documentation for details on the file format. When
passing the placeholder file name "DNA", DNA parameters are loaded without the need
to actually specify any input file.
--nsp=STRING
Allow other pairs in addition to the usual AU,GC,and GU pairs.
Its argument is a comma separated list of additionally allowed pairs. If the first
character is a "-" then AB will imply that AB and BA are allowed pairs. e.g.
RNAfold -nsp -GA will allow GA and AG pairs. Nonstandard pairs are given 0
stacking energy.
-e, --energyModel=INT
Set energy model.
Rarely used option to fold sequences from the artificial ABCD... alphabet, where A
pairs B, C-D etc. Use the energy parameters for GC (-e 1) or AU (-e 2) pairs.
REFERENCES
If you use this program in your work you might want to cite:
R. Lorenz, S.H. Bernhart, C. Hoener zu Siederdissen, H. Tafer, C. Flamm, P.F. Stadler and
I.L. Hofacker (2011), "ViennaRNA Package 2.0", Algorithms for Molecular Biology: 6:26
I.L. Hofacker, W. Fontana, P.F. Stadler, S. Bonhoeffer, M. Tacker, P. Schuster (1994),
"Fast Folding and Comparison of RNA Secondary Structures", Monatshefte f. Chemie: 125, pp
167-188
R. Lorenz, I.L. Hofacker, P.F. Stadler (2016), "RNA folding with hard and soft
constraints", Algorithms for Molecular Biology 11:1 pp 1-13
U. Mueckstein, H. Tafer, J. Hackermueller, S.H. Bernhart, P.F. Stadler, and I.L. Hofacker
(2006), "Thermodynamics of RNA-RNA Binding", Bioinformatics: 22(10), pp 1177-1182
The energy parameters are taken from:
D.H. Mathews, M.D. Disney, D. Matthew, J.L. Childs, S.J. Schroeder, J. Susan, M. Zuker,
D.H. Turner (2004), "Incorporating chemical modification constraints into a dynamic
programming algorithm for prediction of RNA secondary structure", Proc. Natl. Acad. Sci.
USA: 101, pp 7287-7292
D.H Turner, D.H. Mathews (2009), "NNDB: The nearest neighbor parameter database for
predicting stability of nucleic acid secondary structure", Nucleic Acids Research: 38, pp
280-282
EXAMPLES
Output to stdout:
In Interaction mode RNAup prints the most favorable interaction energy between the two
sequences to stdout. The most favorable interaction energy (dG) depends on the position in
the longer sequence (region [i,j]) and the position in the shorter sequence (region[k,l]):
dG[i,j;k,l]. dG[i,j;k,l] is the largest contribution to dG[i,j] = sum_kl dG[i,j;k,l]
which is given in the output file: therefore dG[i,j;k,l] <= dG[i,j].
'....,....1....,....2....,....3....,....4....,....5....,....6....,....7....,....8'
> franz
GGAGUAGGUUAUCCUCUGUU
> sissi
AGGACAACCU
dG = dGint + dGu_l
(((((.((((&)))).))))) 6,15 : 1,10 (-6.66 = -9.89 + 3.23)
AGGUUAUCCU&AGGACAACCU
RNAup output in file: franz_sissi_w25_u3_4_up.out
where the result line contains following information
RNAduplex results [i,j] [k,l] dG = dGint + dGu_l
(((((.((((&)))).))))) 6,15 : 1,10 (-6.66=-9.89+3.23)
Output to file:
Output to file contains a header including date, the command line of the call to RNAup,
length and names of the input sequence(s) followed by the sequence(s). The first sequence
is the target sequence. Printing of the header can be turned off using the -nh option.
The line directly after the header gives the column names for the output:
position dGu_l for -u 3 dGu_l for -u 4 dG
# pos u3S u3H u4S u4H dG
where all information refers to the target sequence. The dGu_l column contains information
about the -u value (u=3 or u=4) and the contribution to the free energy to open all
structures "S" or only hairpin loops "H", see option -c. NA means that no results is
possible (e.g. column u3S row 2: no region of length 3 ending at position 2 exists).
# Thu Apr 10 09:15:11 2008
# RNAup -u 3,4 -c SH -b
# 20 franz
# GGAGUAGGUUAUCCUCUGUU
# 10 sissi
# AGGACAACCU
# pos u3S u3H u4S u4H dG
1 NA NA NA NA -1.540
2 NA NA NA NA -1.540
3 1.371 NA NA NA -1.217
4 1.754 5.777 1.761 NA -1.393
5 1.664 3.140 1.811 5.800 -1.393
If the -b option is selected position and dGu_s values for the shorter sequence are
written after the information for the target sequence.
AUTHOR
Ivo L Hofacker, Peter F Stadler, Ulrike Mueckstein, Ronny Lorenz
REPORTING BUGS
If in doubt our program is right, nature is at fault. Comments should be sent to
rna@tbi.univie.ac.at.