lunar (3) Bio::DB::HTS::Alignment.3pm.gz

LICENSE
Copyright [2015-2018] EMBL-European Bioinformatics Institute Licensed under the Apache License, Version 2.0 (the "License"); you may not use this file except in compliance with the License. You may obtain a copy of the License at http://www.apache.org/licenses/LICENSE-2.0 Unless required by applicable law or agreed to in writing, software distributed under the License is distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the License for the specific language governing permissions and limitations under the License.
NAME
Bio::DB::HTS::Alignment -- The HTS alignment object
SYNOPSIS
use Bio::DB::HTS; my $sam = Bio::DB::HTS->new(-fasta=>"data/ex1.fa", -bam =>"data/ex1.bam"); my @alignments = $sam->get_features_by_location(-seq_id => 'seq2', -start => 500, -end => 800); for my $a (@alignments) { my $seqid = $a->seq_id; my $start = $a->start; my $end = $a->end; my $strand = $a->strand; my $ref_dna= $a->dna; my $query_start = $a->query->start; my $query_end = $a->query->end; my $query_strand = $a->query->strand; my $query_dna = $a->query->dna; my $cigar = $a->cigar_str; my @scores = $a->qscore; # per-base quality scores my $score = $a->qstring; # TAM-style quality string my $match_qual= $a->qual; # quality of the match my $paired = $a->get_tag_values('PAIRED'); }
DESCRIPTION
The Bio::DB::HTS::Alignment and Bio::DB::HTS::AlignWrapper classes together represent an alignment between a sequence read (the "query") and a reference sequence (the "target"). Bio::DB::HTS::Alignment adheres strictly to the C-level BAM library's definition of a bam1_t* and is used in the Bio::DB::HTS low-level API The latter adds convenience methods that make it similar to a BioPerl Bio::SeqFeatureI object. This manual page describes both.
High-level Bio::DB::HTS::Alignment methods
These methods are provided by Bio::DB::HTS::Alignment, and are intended to be compatible with the Bio::SeqFeatureI interfaces. Note that these objects are not compatible with Bio::Align::AlignI, as the BAM API is fundamentally incompatible with the BioPerl API for alignments (the first deals with the alignment of a single read against the reference sequence, while the second deals with a multiple alignment). Note that the high-level API return Bio::DB::HTS::AlignWrapper objects except in the case of the callback to the fast_pileup() method. In this case only, the object returned by calling $pileup->b() is a Bio::DB::HTS::Alignment object for performance reasons. $seq_id = $align->seq_id Return the seq_id of the reference (target) sequence. This method is only available in the Bio::DB::HTS::AlignWrapper extension. $start = $align->start Return the start of the alignment in 1-based reference sequence coordinates. $end = $align->end Return the end of the alignment in 1-based reference sequence coordinates. $len = $align->length Return the length of the alignment on the reference sequence. $mseqid = $align->mate_seq_id Return the seq_id of the mate's reference (target) sequence. This method is only available in the Bio::DB::AlignWrapper extension. $mstart = $align->mate_start For paired reads, return the start of the mate's alignment in 1-based reference sequence coordinates. $mend = $align->mate_end For paired reads, return the end position of the mate's alignment in 1-based reference sequence coordinates. $mlen = $align->mate_len For mate-pairs, retrieve the length of the mate's alignment on the reference sequence. $strand = $align->strand Return the strand of the alignment as -1 for reversed, +1 for forward. $mstrand = $align->mstrand If the read has a mate pair, return the strand of the mate in the format -1 or +1. $ref_dna = $align->dna Returns the reference sequence's DNA across the aligned region. If an MD tag is present in the alignment, it will be used preferentially to reconstruct the reference sequence. Otherwise the reference DNA access object passed to Bio::DB::HTS->new() will be used. $ref_dna = $align->seq The reference sequence's DNA as a Bio::PrimarySeqI object (useful for passing to BioPerl functions and for calculating subsequences and reverse complements). $query = $align->query This method returns a Bio::DB::Alignment::Query object that can be used to retrieve information about the query sequence. The next few entries show how to use this object. $read_name = $align->query->name The name of the read. $q_start = $align->query->start This returns the start position of the query (read) sequence in 1-based coordinates. It acts via a transient Bio::DB::HTS::Query object that is provided for Bio::Graphics compatibility (see Bio::Graphics). $q_end = $align->query->end This returns the end position of the query sequence in 1-based coordinates. $q_len = $align->query->length Return the length of the alignment on the read. $scores = $align->query->score Return an array reference containing the unpacked quality scores for each base of the query sequence. The length of this array reference will be equal to the length of the read. $read_dna = $align->query->dna The read's DNA string. $read_seq = $align->query->seq The read's DNA as a Bio::PrimarySeqI object. $target = $align->target; The target() method is similar to query(), except that it follows Bio::AlignIO conventions for how to represent minus strand alignments. The object returned has start(), end(), qscore(), dna() and seq() methods, but for minus strand alignments the sequence will be represented as it appears on the reverse strand, rather than on the forward strand. This has the advantage of giving you the read as it came off the machine, before being reverse complemented for use in the SAM file. $query = $align->hit The hit() method is identical to target() and returns information about the read. It is present for compatibility with some of the Bio::Graphics glyphs, which use hit() to represent the non-reference sequence in aligned sequences. $primary_id = $align->primary_id This method synthesizes a unique ID for the alignment which can be passed to $sam->get_feature_by_id() to retrieve the alignment at a later date. @tags = $align->get_all_tags Return all tag names known to this alignment. This includes SAM flags such as M_UNMAPPED, as well as auxiliary flags such as H0. The behavior of this method depends on the value of -expand_flags when the SAM object was created. If false (the default), then the standard SAM flags will be concatenated together into a single string and stored in a tag named 'FLAGS'. The format of this tag value is the list of one or more flag constants separated by the "|" character, as in: "PAIRED|MAP_PAIR|REVERSED|SECOND_MATE". If -expand_flags was true, then each flag becomes its own named tag, such as "MAP_PAIR". @values = $align->get_tag_values($tag) Given a tag name, such as 'PAIRED' or 'H0', return its value(s). -expand_flags must be true in order to use the standard SAM flag constants as tags. Otherwise, they can be fetched by asking for the "FLAGS" tag, or by using the low-level methods described below. $is_true = $align->has_tag($tag) Return true if the alignment has the indicated tag. $string = $align->cigar_str Return the CIGAR string for this alignment in conventional human readable format (e.g. "M34D1M1"). $arrayref = $align->cigar_array Return a reference to an array representing the CIGAR string. This is an array of arrays, in which each subarray consists of a CIGAR operation and a count. Example: [ ['M',34], ['D',1], ['M',1] ] ($ref,$matches,$query) = $align->padded_alignment Return three strings that show the alignment between the reference sequence (the target) and the query. It will look like this: $ref AGTGCCTTTGTTCA-----ACCCCCTTGCAACAACC $matches |||||||||||||| ||||||||||||||||| $query AGTGCCTTTGTTCACATAGACCCCCTTGCAACAACC $str = $align->aux Returns the text version of the SAM tags, e.g. "XT:A:M NM:i:2 SM:i:37 AM:i:37 XM:i:1 XO:i:1 XG:i:1 MD:Z:6^C0A47" $str = $align->tam_line Returns the TAM (text) representation of the alignment (available in the high-level "AlignWrapper" interface only). $tag = $align->primary_tag This is provided for Bio::SeqFeatureI compatibility. Return the string "match". $tag = $align->source_tag This is provided for Bio::SeqFeatureI compatibility. Return the string "sam/bam". @parts = $align->get_SeqFeatures Return subfeatures of this alignment. If you have fetched a "read_pair" feature, this will be the two mate pair objects (both of type Bio::DB::HTS::AlignWrapper). If you have -split_splices set to true in the Bio::DB::HTS database, calling get_SeqFeatures() will return the components of split alignments. See "Bio::DB::HTS Constructor and basic accessors" in Bio::DB::HTS for an example of how to use this.
Low-level Bio::DB::HTS::Alignment methods
These methods are available to objects of type Bio::DB::HTS::Alignment as well as Bio::DB::HTS::AlignWrapper and closely mirror the native C API. $align = Bio::DB::HTS::Alignment->new Create a new, empty alignment object. This is usually needed when iterating through a HTS file using Bio::DB::HTS->read1(). $tid = $align->tid( [$new_tid] ) Return the target ID of the alignment. Optionally you may change the tid by providing it as an argument (currently this is the only field that you can change; the functionality was implemented as a proof of principle). $read_name = $align->qname Returns the name of the read. $pos = $align->pos 0-based leftmost coordinate of the aligned sequence on the reference sequence. $end = $align->calend The 0-based rightmost coordinate of the aligned sequence on the reference sequence after taking alignment gaps into account. $len = $align->cigar2qlen The length of the query sequence calculated from the CIGAR string. $quality = $align->qual The quality score for the alignment as a whole. $flag = $align->flag The bitwise flag field (see the SAM documentation). $mtid = $align->mtid For paired reads, the target ID of the mate's alignemnt. $mpos = $align->mpos For paired reads, the 0-based leftmost coordinate of the mate's alignment on the reference sequence. $n_cigar = $align->n_cigar Number of CIGAR operations in this alignment. $length = $align->l_qseq The length of the query sequence (the read). $dna = $align->qseq The actual DNA sequence of the query. As in the SAM file, reads that are aligned to the minus strand of the reference are returned in reverse complemented form. $score_str = $align->_qscore A packed binary string containing the quality scores for each base of the read. It will be the same length as the DNA. You may unpack it using unpack('C*',$score_str), or use the high-level qscore() method. $score_arry = $align->qscore @score_arry = $align->qscore In a scalar context return an array reference containing the unpacked quality scores for each base of the query sequence. In a list context return a list of the scores. This array is in the same orientation as the reference sequence. $score_str = $align->qstring Returns the quality string in the same format used in the SAM (TAM) file. $length = $align->isize The calculated insert size for mapped paired reads. $length = $align->l_aux The length of the align "auxiliary" data. $value = $align->aux_get("tag") Given an auxiliary tag, such as "H0", return its value. @keys = $align->aux_keys Return the list of auxiliary tags known to this alignment. $data = $align->data Return a packed string containing the alignment data (sequence, quality scores and cigar string). $length = $align->data_len Return the current length of the alignment data. $length = $align->m_data Return the maximum length of the alignment data. $is_paired = $align->paired Return true if the aligned read is part of a mate/read pair (regardless of whether the mate mapped). $is_proper = $align->proper_pair Return true if the aligned read is part of a mate/read pair and both partners mapped to the reference sequence. $is_unmapped = $align->unmapped Return true if the read failed to align. $mate_is_unmapped = $align->munmapped Return true if the read's mate failed to align. $reversed = $align->reversed Return true if the aligned read was reverse complemented prior to aligning. $mate_reversed = $align->mreversed Return true if the aligned read's mate was reverse complemented prior to aligning. $isize = $align->isize For mate-pairs, return the computed insert size. $arrayref = $align->cigar This returns the CIGAR data in its native BAM format. You will receive an arrayref in which each operation and count are packed together into an 8-bit structure. To decode each element you must use the following operations: use Bio::DB::HTS::Constants; my $c = $align->cigar; my $op = $c->[0] & BAM_CIGAR_MASK; my $len = $c->[0] >> BAM_CIGAR_SHIFT;
AUTHOR
Rishi Nag <rishi@ebi.ac.uk<gt>
SEE ALSO
Bio::Perl, Bio::DB::HTS, Bio::DB::HTS::Constants