Provided by: vienna-rna_2.6.4+dfsg-1build1_amd64 
NAME
RNAfold - manual page for RNAfold 2.6.4
SYNOPSIS
RNAfold [OPTIONS] [<input0.fa>] [<input1.fa>]...
DESCRIPTION
RNAfold 2.6.4
Calculate minimum free energy secondary structures and partition function of RNAs
The program reads RNA sequences, calculates their minimum free energy (mfe) structure and
prints the mfe structure in bracket notation and its free energy. If not specified
differently using commandline arguments, input is accepted from stdin or read from an
input file, and output printed to stdout. If the -p option was given it also computes the
partition function (pf) and base pairing probability matrix, and prints the free energy of
the thermodynamic ensemble, the frequency of the mfe structure in the ensemble, and the
ensemble diversity to stdout.
It also produces PostScript files with plots of the resulting secondary structure graph
and a "dot plot" of the base pairing matrix. The dot plot shows a matrix of squares with
area proportional to the pairing probability in the upper right half, and one square for
each pair in the minimum free energy structure in the lower left half. For each pair i-j
with probability p>10E-6 there is a line of the form
i j sqrt(p) ubox
in the PostScript file, so that the pair probabilities can be easily extracted.
Sequences may be provided in a simple text format where each sequence occupies a single
line. Output files are named "rna.ps" and "dot.ps". Existing files of the same name will
be overwritten.
It is also possible to provide sequence data in FASTA format. In this case, the first word
of the FASTA header will be used as prefix for output file names. PostScript files
"prefix_ss.ps" and "prefix_dp.ps" are produced for the structure and dot plot,
respectively. Note, however, that once FASTA input was provided all following sequences
must be in FASTA format too.
To avoid problems with certain operating systems and/or file systems the prefix will
ALWAYS be sanitized! This step substitutes any special character in the prefix by a
filename delimiter. See the --filename-delim option to change the delimiting character
according to your requirements.
The program will continue to read new sequences until a line consisting of the single
character '@' or an end of file (EOF) condition is encountered.
-h, --help
Print help and exit
--detailed-help
Print help, including all details and hidden options, and exit
--full-help
Print help, including hidden options, and exit
-V, --version
Print version and exit
-v, --verbose
Be verbose.
(default=off)
I/O Options:
Command line options for input and output (pre-)processing
-i, --infile=filename
Read a file instead of reading from stdin.
The default behavior of RNAfold is to read input from stdin or the file(s) that
follow(s) the RNAfold command. Using this parameter the user can specify input file
names where data is read from. Note, that any additional files supplied to RNAfold
are still processed as well.
-o, --outfile[=filename]
Print output to file instead of stdout.
This option may be used to write all output to output files rather than printing to
stdout. The default filename is "RNAfold_output.fold" if no FASTA header precedes
the input sequences and the --auto-id feature is inactive. Otherwise, output files
with the scheme "prefix.fold" are generated, where the "prefix" is taken from the
sequence id, e.g. the FASTA header. The user may specify a single output file name
for all data generated from the input by supplying a filename as argument following
immediately after this parameter. In case a file with the same filename already
exists, any output of the program will be appended to it. Note: Any special
characters in the filename will be replaced by the filename delimiter, hence there
is no way to pass an entire directory path through this option (yet). (See also the
"--filename-delim" parameter)
-j, --jobs[=number]
Split batch input into jobs and start processing in parallel using multiple
threads. A value of 0 indicates to use as many parallel threads as computation
cores are available.
(default=`0')
Default processing of input data is performed in a serial fashion, i.e. one
sequence at a time. Using this switch, a user can instead start the computation for
many sequences in the input in parallel. RNAfold will create as many parallel
computation slots as specified and assigns input sequences of the input file(s) to
the available slots. Note, that this increases memory consumption since input
alignments have to be kept in memory until an empty compute slot is available and
each running job requires its own dynamic programming matrices.
--unordered
Do not try to keep output in order with input while parallel processing is in
place.
(default=off)
When parallel input processing (--jobs flag) is enabled, the order in which input
is processed depends on the host machines job scheduler. Therefore, any output to
stdout or files generated by this program will most likely not follow the order of
the corresponding input data set. The default of RNAfold is to use a specialized
data structure to still keep the results output in order with the input data.
However, this comes with a trade-off in terms of memory consumption, since all
output must be kept in memory for as long as no chunks of consecutive, ordered
output are available. By setting this flag, RNAfold will not buffer individual
results but print them as soon as they have been computated.
--noconv
Do not automatically substitute nucleotide "T" with "U".
(default=off)
--auto-id
Automatically generate an ID for each sequence. (default=off)
The default mode of RNAfold is to automatically determine an ID from the input
sequence data if the input file format allows to do that. Sequence IDs are usually
given in the FASTA header of input sequences. If this flag is active, RNAfold
ignores any IDs retrieved from the input and automatically generates an ID for each
sequence. This ID consists of a prefix and an increasing number. This flag can also
be used to add a FASTA header to the output even if the input has none.
--id-prefix=STRING
Prefix for automatically generated IDs (as used in output file names).
(default=`sequence')
If this parameter is set, each sequence will be prefixed with the provided string.
Hence, the output files will obey the following naming scheme: "prefix_xxxx_ss.ps"
(secondary structure plot), "prefix_xxxx_dp.ps" (dot-plot), "prefix_xxxx_dp2.ps"
(stack probabilities), etc. where xxxx is the sequence number. Note: Setting this
parameter implies --auto-id.
--id-delim=CHAR
Change the delimiter between prefix and increasing number for automatically
generated IDs (as used in output file names).
(default=`_')
This parameter can be used to change the default delimiter "_" between the prefix
string and the increasing number for automatically generated ID.
--id-digits=INT
Specify the number of digits of the counter in automatically generated alignment
IDs.
(default=`4')
When alignments IDs are automatically generated, they receive an increasing number,
starting with 1. This number will always be left-padded by leading zeros, such that
the number takes up a certain width. Using this parameter, the width can be
specified to the users need. We allow numbers in the range [1:18]. This option
implies --auto-id.
--id-start=LONG
Specify the first number in automatically generated IDs.
(default=`1')
When sequence IDs are automatically generated, they receive an increasing number,
usually starting with 1. Using this parameter, the first number can be specified to
the users requirements. Note: negative numbers are not allowed. Note: Setting this
parameter implies to ignore any IDs retrieved from the input data, i.e. it
activates the --auto-id flag.
--filename-delim=CHAR
Change the delimiting character used in sanitized filenames.
(default=`ID-delimiter')
This parameter can be used to change the delimiting character used while sanitizing
filenames, i.e. replacing invalid characters. Note, that the default delimiter
ALWAYS is the first character of the "ID delimiter" as supplied through the
--id-delim option. If the delimiter is a whitespace character or empty, invalid
characters will be simply removed rather than substituted. Currently, we regard the
following characters as illegal for use in filenames: backslash '\', slash '/',
question mark '?', percent sign '%', asterisk '*', colon ':', pipe symbol '|',
double quote '"', triangular brackets '<' and '>'.
--filename-full
Use full FASTA header to create filenames. (default=off)
This parameter can be used to deactivate the default behavior of limiting output
filenames to the first word of the sequence ID. Consider the following example: An
input with FASTA header '>NM_0001 Homo Sapiens some gene' usually produces output
files with the prefix "NM_0001" without the additional data available in the FASTA
header, e.g. "NM_0001_ss.ps" for secondary structure plots. With this flag set, no
truncation of the output filenames is done, i.e. output filenames receive the full
FASTA header data as prefixes. Note, however, that invalid characters (such as
whitespace) will be substituted by a delimiting character or simply removed, (see
also the parameter option --filename-delim).
Algorithms:
Select additional algorithms which should be included in the calculations. The
Minimum free energy (MFE) and a structure representative are calculated in any
case.
-p, --partfunc[=INT]
Calculate the partition function and base pairing probability matrix.
(default=`1')
In addition to the MFE structure we print a coarse representation of the pair
probabilities in form of a pseudo bracket notation followed by the ensemble free
energy. This notation makes use of the letters '.', ',', '|', '{', '}', '(', and
')' denoting bases that are essentially unpaired, weakly paired, strongly paired
without preference, weakly upstream (downstream) paired, or strongly up-
(down-)stream paired bases, respectively. On the next line the centroid structure
as derived from the pair probabilities together with its free energy and distance
to the ensemble is shown. Finally it prints the frequency of the mfe structure, and
the structural diversity (mean distance between the structures in the ensemble).
See the description of 'vrna_pf()' and 'mean_bp_dist()' and 'vrna_centroid()' in
the RNAlib documentation for details. Note that unless you also specify -d2 or
-d0, the partition function and mfe calculations will use a slightly different
energy model. See the discussion of dangling end options below.
An additionally passed value to this option changes the behavior of partition
function calculation: -p0 Calculate the partition function but not the pair
probabilities, saving about 50% in runtime. This prints the ensemble free energy
'dG=-kT ln(Z)'. -p2 Compute stack probabilities, i.e. the probability that a pair
'(i,j)' and the immediately interior pair '(i+1,j-1)' are formed simultaneously in
addition to pair probabilities. A second postscript dot plot named "name_dp2.ps",
or "dot2.ps" (if the sequence does not have a name), is produced that contains pair
probabilities in the upper right half and stack probabilities in the lower left.
--betaScale=DOUBLE
Set the scaling of the Boltzmann factors. (default=`1.')
The argument provided with this option is used to scale the thermodynamic
temperature in the Boltzmann factors independently from the temperature of the
individual loop energy contributions. The Boltzmann factors then become 'exp(-
dG/(kT*betaScale))' where 'k' is the Boltzmann constant, 'dG' the free energy
contribution of the state and 'T' the absolute temperature.
-S, --pfScale=DOUBLE
In the calculation of the pf use scale*mfe as an estimate for the ensemble free
energy (used to avoid overflows).
(default=`1.07')
The default is 1.07, useful values are 1.0 to 1.2. Occasionally needed for long
sequences.
--MEA[=gamma]
Compute MEA (maximum expected accuracy) structure.
(default=`1.')
The expected accuracy is computed from the pair probabilities: each base pair
'(i,j)' receives a score '2*gamma*p_ij' and the score of an unpaired base is given
by the probability of not forming a pair. The parameter gamma tunes the importance
of correctly predicted pairs versus unpaired bases. Thus, for small values of gamma
the MEA structure will contain only pairs with very high probability. Using --MEA
implies -p for computing the pair probabilities.
-c, --circ
Assume a circular (instead of linear) RNA molecule.
(default=off)
--ImFeelingLucky
Return exactly one stochastically backtracked structure.
(default=off)
This function computes the partition function and returns exactly one secondary
structure stochastically sampled from the Boltzmann equilibrium according to its
probability in the ensemble
--bppmThreshold=cutoff
Set the threshold/cutoff for base pair probabilities included in the postscript
output.
(default=`1e-5')
By setting the threshold the base pair probabilities that are included in the
output can be varied. By default only those exceeding '1e-5' in probability will be
shown as squares in the dot plot. Changing the threshold to any other value allows
for increase or decrease of data.
-g, --gquad
Incoorporate G-Quadruplex formation into the structure prediction algorithm.
(default=off)
Structure Constraints:
Command line options to interact with the structure constraints feature of this
program
--maxBPspan=INT
Set the maximum base pair span.
(default=`-1')
-C, --constraint[=filename]
Calculate structures subject to constraints. (default=`')
The program reads first the sequence, then a string containing constraints on the
structure encoded with the symbols:
'.' (no constraint for this base)
'|' (the corresponding base has to be paired
'x' (the base is unpaired)
'<' (base i is paired with a base j>i)
'>' (base i is paired with a base j<i)
and matching brackets '(' ')' (base i pairs base j)
With the exception of '|', constraints will disallow all pairs conflicting with the
constraint. This is usually sufficient to enforce the constraint, but occasionally
a base may stay unpaired in spite of constraints. PF folding ignores constraints of
type '|'.
--batch
Use constraints for multiple sequences. (default=off)
Usually, constraints provided from input file only apply to a single input
sequence. Therefore, RNAfold will stop its computation and quit after the first
input sequence was processed. Using this switch, RNAfold processes multiple input
sequences and applies the same provided constraints to each of them.
--canonicalBPonly
Remove non-canonical base pairs from the structure constraint.
(default=off)
--enforceConstraint
Enforce base pairs given by round brackets '(' ')' in structure constraint.
(default=off)
--shape=filename
Use SHAPE reactivity data to guide structure predictions.
--shapeMethod=method
Select SHAPE reactivity data incorporation strategy.
(default=`D')
The following methods can be used to convert SHAPE reactivities into pseudo energy
contributions.
'D': Convert by using the linear equation according to Deigan et al 2009.
Derived pseudo energy terms will be applied for every nucleotide involved in a
stacked pair. This method is recognized by a capital 'D' in the provided parameter,
i.e.: --shapeMethod="D" is the default setting. The slope 'm' and the intercept 'b'
can be set to a non-default value if necessary, otherwise m=1.8 and b=-0.6. To
alter these parameters, e.g. m=1.9 and b=-0.7, use a parameter string like this:
--shapeMethod="Dm1.9b-0.7". You may also provide only one of the two parameters
like: --shapeMethod="Dm1.9" or --shapeMethod="Db-0.7".
'Z': Convert SHAPE reactivities to pseudo energies according to Zarringhalam
et al 2012. SHAPE reactivities will be converted to pairing probabilities by using
linear mapping. Aberration from the observed pairing probabilities will be
penalized during the folding recursion. The magnitude of the penalties can affected
by adjusting the factor beta (e.g. --shapeMethod="Zb0.8").
'W': Apply a given vector of perturbation energies to unpaired nucleotides
according to Washietl et al 2012. Perturbation vectors can be calculated by using
RNApvmin.
--shapeConversion=method
Select method for SHAPE reactivity conversion.
(default=`O')
This parameter is useful when dealing with the SHAPE incorporation according to
Zarringhalam et al. The following methods can be used to convert SHAPE reactivities
into the probability for a certain nucleotide to be unpaired.
'M': Use linear mapping according to Zarringhalam et al. 'C': Use a
cutoff-approach to divide into paired and unpaired nucleotides (e.g. "C0.25") 'S':
Skip the normalizing step since the input data already represents probabilities for
being unpaired rather than raw reactivity values 'L': Use a linear model to convert
the reactivity into a probability for being unpaired (e.g. "Ls0.68i0.2" to use a
slope of 0.68 and an intercept of 0.2) 'O': Use a linear model to convert the log
of the reactivity into a probability for being unpaired (e.g. "Os1.6i-2.29" to use
a slope of 1.6 and an intercept of -2.29)
--motif=SEQUENCE,STRUCTURE,ENERGY
Specify stabilizing energy of a ligand binding
to a particular sequence/structure motif.
Some ligands binding to RNAs require and/or induce particular sequence and
structure motifs. For instance they bind to an interior loop, or small hairpin
loop. If for such cases a binding free energy is known, the binding and therefore
stabilizing effect of the ligand can be included in the folding recursions.
Interior loop motifs are specified as concatenations of 5' and 3' motif, separated
by an '&' character.
Energy contributions must be specified in kcal/mol.
See the manpage for an example usage of this option.
--commands=filename
Read additional commands from file
Commands include hard and soft constraints, but also structure motifs in hairpin
and interior loops that need to be treeted differently. Furthermore, commands can
be set for unstructured and structured domains.
Energy Parameters:
Energy parameter sets can be adapted or loaded from user-provided input files
-T, --temp=DOUBLE
Rescale energy parameters to a temperature of temp C. Default is 37C.
(default=`37.0')
-P, --paramFile=paramfile
Read energy parameters from paramfile, instead of using the default parameter set.
Different sets of energy parameters for RNA and DNA should accompany your
distribution. See the RNAlib documentation for details on the file format. The
placeholder file name 'DNA' can be used to load DNA parameters without the need to
actually specify any input file.
-4, --noTetra
Do not include special tabulated stabilizing energies for tri-, tetra- and hexaloop
hairpins.
(default=off)
Mostly for testing.
--salt=DOUBLE
Set salt concentration in molar (M). Default is 1.021M.
-m, --modifications[=STRING]
Allow for modified bases within the RNA sequence string.
(default=`7I6P9D')
Treat modified bases within the RNA sequence differently, i.e. use corresponding
energy corrections and/or pairing partner rules if available. For that, the
modified bases in the input sequence must be marked by their corresponding
one-letter code. If no additional arguments are supplied, all available corrections
are performed. Otherwise, the user may limit the modifications to a particular
subset of modifications, resp. one-letter codes, e.g. -mP6 will only correct for
pseudouridine and m6A bases.
Currently supported one-letter codes and energy corrections are:
'7': 7-deaza-adenonsine (7DA)
'I': Inosine
'6': N6-methyladenosine (m6A)
'P': Pseudouridine
'9': Purine (a.k.a. nebularine)
'D': Dihydrouridine
--mod-file=STRING
Use additional modified base data from JSON file.
Model Details:
Tweak the energy model and pairing rules additionally using the following
parameters
-d, --dangles=INT
How to treat "dangling end" energies for bases adjacent to helices in free ends and
multi-loops.
(default=`2')
With -d1 only unpaired bases can participate in at most one dangling end. With -d2
this check is ignored, dangling energies will be added for the bases adjacent to a
helix on both sides in any case; this is the default for mfe and partition function
folding (-p). The option -d0 ignores dangling ends altogether (mostly for
debugging). With -d3 mfe folding will allow coaxial stacking of adjacent helices
in multi-loops. At the moment the implementation will not allow coaxial stacking of
the two interior pairs in a loop of degree 3 and works only for mfe folding.
Note that with -d1 and -d3 only the MFE computations will be using this setting
while partition function uses -d2 setting, i.e. dangling ends will be treated
differently.
--noLP Produce structures without lonely pairs (helices of length 1).
(default=off)
For partition function folding this only disallows pairs that can only occur
isolated. Other pairs may still occasionally occur as helices of length 1.
--noGU Do not allow GU pairs.
(default=off)
--noClosingGU
Do not allow GU pairs at the end of helices.
(default=off)
--nsp=STRING
Allow other pairs in addition to the usual AU,GC,and GU pairs.
Its argument is a comma separated list of additionally allowed pairs. If the first
character is a "-" then AB will imply that AB and BA are allowed pairs, e.g.
--nsp="-GA" will allow GA and AG pairs. Nonstandard pairs are given 0 stacking
energy.
-e, --energyModel=INT
Set energy model.
Rarely used option to fold sequences from the artificial ABCD... alphabet, where A
pairs B, C-D etc. Use the energy parameters for GC (-e 1) or AU (-e 2) pairs.
--helical-rise=FLOAT
Set the helical rise of the helix in units of Angstrom.
(default=`2.8')
Use with caution! This value will be re-set automatically to 3.4 in case DNA
parameters are loaded via -P DNA and no further value is provided.
--backbone-length=FLOAT
Set the average backbone length for looped regions in units of Angstrom.
(default=`6.0')
Use with caution! This value will be re-set automatically to 6.76 in case DNA
parameters are loaded via -P DNA and no further value is provided.
Plotting:
Command line options for changing the default behavior of structure layout and
pairing probability plots
--noPS Do not produce postscript drawing of the mfe structure.
(default=off)
--noDP Do not produce dot-plot postscript file containing base pair or stack
probabilitities.
(default=off)
In combination with the -p option, this flag turns-off creation of individual
dot-plot files. Consequently, computed base pair probability output is omitted but
centroid and MEA structure prediction is still performed.
-t, --layout-type=INT
Choose the layout algorithm. (default=`1')
Select the layout algorithm that computes the nucleotide coordinates. Currently,
the following algorithms are available:
'0': simple radial layout
'1': Naview layout (Bruccoleri et al. 1988)
'2': circular layout
'3': RNAturtle (Wiegreffe et al. 2018)
'4': RNApuzzler (Wiegreffe et al. 2018)
REFERENCES
If you use this program in your work you might want to cite:
R. Lorenz, S.H. Bernhart, C. Hoener zu Siederdissen, H. Tafer, C. Flamm, P.F. Stadler and
I.L. Hofacker (2011), "ViennaRNA Package 2.0", Algorithms for Molecular Biology: 6:26
I.L. Hofacker, W. Fontana, P.F. Stadler, S. Bonhoeffer, M. Tacker, P. Schuster (1994),
"Fast Folding and Comparison of RNA Secondary Structures", Monatshefte f. Chemie: 125, pp
167-188
R. Lorenz, I.L. Hofacker, P.F. Stadler (2016), "RNA folding with hard and soft
constraints", Algorithms for Molecular Biology 11:1 pp 1-13
M. Zuker, P. Stiegler (1981), "Optimal computer folding of large RNA sequences using
thermodynamic and auxiliary information", Nucl Acid Res: 9, pp 133-148
J.S. McCaskill (1990), "The equilibrium partition function and base pair binding
probabilities for RNA secondary structures", Biopolymers: 29, pp 1105-1119
I.L. Hofacker & P.F. Stadler (2006), "Memory Efficient Folding Algorithms for Circular RNA
Secondary Structures", Bioinformatics
A.F. Bompfuenewerer, R. Backofen, S.H. Bernhart, J. Hertel, I.L. Hofacker, P.F. Stadler,
S. Will (2007), "Variations on {RNA} Folding and Alignment: Lessons from Benasque", J.
Math. Biol.
D. Adams (1979), "The hitchhiker's guide to the galaxy", Pan Books, London
The calculation of mfe structures is based on dynamic programming algorithm originally
developed by M. Zuker and P. Stiegler. The partition function algorithm is based on work
by J.S. McCaskill.
The energy parameters are taken from:
D.H. Mathews, M.D. Disney, D. Matthew, J.L. Childs, S.J. Schroeder, J. Susan, M. Zuker,
D.H. Turner (2004), "Incorporating chemical modification constraints into a dynamic
programming algorithm for prediction of RNA secondary structure", Proc. Natl. Acad. Sci.
USA: 101, pp 7287-7292
D.H Turner, D.H. Mathews (2009), "NNDB: The nearest neighbor parameter database for
predicting stability of nucleic acid secondary structure", Nucleic Acids Research: 38, pp
280-282
EXAMPLES
Single line sequence input and calculation of partition function and MEA structure
$ RNAfold --MEA -d2 -p
The program will then prompt for sequence input. Using the example sequence
"CGACGTAGATGCTAGCTGACTCGATGC" and pressing ENTER the output of the program will be similar
to
CGACGUAGAUGCUAGCUGACUCGAUGC
(((.((((.......)).)))))....
minimum free energy = -1.90 kcal/mol
(((.((((.......))},})))....
free energy of ensemble = -2.86 kcal/mol
(((.(.((.......))..)))).... { 0.80 d=2.81}
(((.((((.......))).)))).... { -1.90 MEA=22.32}
frequency of mfe structure in ensemble 0.20997; ensemble diversity 4.19
Here, the first line just repeats the sequence input. The second line contains a MFE
structure in dot bracket notation followed by the minimum free energy. After this, the
pairing probabilities for each nucleotide are shown in a pseudo dot-bracket notation
followed by the free energy of ensemble. The next two lines show the centroid structure
with its free energy and its distance to the ensemble as well as the MEA structure, its
free energy and the maximum expected accuracy, respectively. The last line finally
contains the frequency of the MFE representative in the complete ensemble of secondary
structures and the ensemble diversity. For further details about the calculation and
interpretation of the given output refer to the reference manual of RNAlib.
Since version 2.0 it is also possible to provide FASTA file sequence input. Assume you
have a file containing two sequences in FASTA format, e.g
$ cat sequences.fa
>seq1
CGGCUCGCAACAGACCUAUUAGUUUUACGUAAUAUUUG
GAACGAUCUAUAACACGACUUCACUCUU
>seq2
GAAUGACCCGAUAACCCCGUAAUAUUUGGAACGAUCUA
UAACACGACUUCACUCUU
In order to compute the MFE for the two sequences the user can use the following command
$ RNAfold < sequences.fa
which would result in an output like this
>seq1
CGGCUCGCAACAGACCUAUUAGUUUUACGUAAUAUUUGGAACGAUCUAUAACACGACUUCACUCUU
.((.(((...((((..(((((........)))))))))...))).))................... ( -5.40)
>seq2
GAAUGACCCGAUAACCCCGUAAUAUUUGGAACGAUCUAUAACACGACUUCACUCUU
.......((((..............))))........................... ( -2.00)
CONSTRAINT EXAMPLES
Secondary structure constraints may be given in addition to the sequence information, too.
Using the first sequence of the previous example and restricting the nucleotides of the
outermost helix to be unpaired, i.e. base pairs (2,47) and (3,46) the input file should
have the following form
$ cat sequence_unpaired.fa
>seq1
CGGCUCGCAACAGACCUAUUAGUUUUACGUAAUAUUUG
GAACGAUCUAUAACACGACUUCACUCUU
.xx...................................
.......xx...................
Calling RNAfold with the structure constraint option -C it shows the following result
$ RNAfold -C < sequence_unpaired.fa
>seq1
CGGCUCGCAACAGACCUAUUAGUUUUACGUAAUAUUUGGAACGAUCUAUAACACGACUUCACUCUU
....(((...((((..(((((........)))))))))...)))...................... ( -4.20)
This represents the minimum free energy and a structure representative of the RNA sequence
given that nucleotides 2,3,46 and 47 must not be involved in any base pair. For further
information about constrained folding refer to the details of the -C option and the
reference manual of RNAlib.
Since version 2.2 the ViennaRNA Package distinguishes hard and soft constraints. As a
consequence, structure predictions are easily amenable to a versatile set of constraints,
such as maximal base pair span, incorporation of SHAPE reactivity data, and RNA-ligand
binding to hairpin, or interior loop motifs.
Restricting the maximal span of a base pair
A convenience commandline option allows you to easily limit the distance (j - i + 1)
between two nucleotides i and j that form a basepair. For instance a limit of 600nt can be
accomplished using:
$ RNAfold --maxBPspan 600
Guide structure prediction with SHAPE reactivity data
Use SHAPE reactivity data to guide secondary structure prediction:
$ RNAfold --shape=reactivities.dat < sequence.fa
where the file reactivities.dat is a two column text file with sequence positions
(1-based) and normalized reactivity values (usually between 0 and 2. Missing values may be
left out, or assigned a negative score:
$ cat reactivities.dat
9 -999 # No reactivity information
10 -999
11 0.042816 # normalized SHAPE reactivity
12 0 # also a valid SHAPE reactivity
15 0.15027 # Missing data for pos. 13-14
...
42 0.16201
Note, that RNAfold will only process the first sequence in the input file, when provided
with SHAPE reactivity data!
Complex structure constraints and grammar extensions
Structure constraints beyond those that can be expressed with a pseudo-dot bracket
notation may be provided in a so-called command file:
$ RNAfold --commands=constraints.txt < sequence.fa
The command file syntax is a generalization of constraints as used in UNAfold/mfold. Each
line starts with a one or two letter command followed by command parameters. For structure
constraints, this amounts to a single command character followed by three or four numbers.
In addition, optional auxiliary modifier characters may be used to limit the constraint to
specific loop types. For base pair specific constraints, we currently distinguish pairs in
exterior loops (E), closing pairs of hairpin loops (H), closing (I) and enclosed (i) pairs
of interior loops, and closing (M) and enclosed (m) pairs of multibranch loops.
Nucleotide-wise constraints may be limited to their loop context using the corresponding
uppercase characters. The default is to apply a constraint to all (A) loop types.
Furthermore, pairing constraints for single nucleotides may be limited to upstream (U), or
downstream (D) orientation. The command file specification is as follows:
F i 0 k [TYPE] [ORIENTATION] # Force nucleotides i...i+k-1 to be paired
F i j k [TYPE] # Force helix of size k starting with (i,j) to be formed
P i 0 k [TYPE] # Prohibit nucleotides i...i+k-1 to be paired
P i j k [TYPE] # Prohibit pairs (i,j),...,(i+k-1,j-k+1)
P i-j k-l [TYPE] # Prohibit pairing between two ranges
C i 0 k [TYPE] # Nucleotides i,...,i+k-1 must appear in context TYPE
C i j k # Remove pairs conflicting with (i,j),...,(i+k-1,j-k+1)
E i 0 k e # Add pseudo-energy e to nucleotides i...i+k-1
E i j k e # Add pseudo-energy e to pairs (i,j),...,(i+k-1,j-k+1)
UD m e [LOOP] # Add ligand binding to unstructured domains with motif
# m and binding free energy e
# [LOOP] = { E, H, I, M, A }
# [TYPE] = [LOOP] + { i, m }
# [ORIENTATION] = { U, D }
Again, RNAfold by default only processes the first sequence in the input sequence when
provided with constraints in a command file. To apply the exact same constraints to each
of the input sequences in a multi FASTA file, use the batch mode commandline option:
$ RNAfold --constraint=constraints.txt --batch < sequences.fa
Ligand binding contributions to specific hairpin/interior loop motifs
A convenience function allows one to specify a hairping/interior loop motif where a ligand
is binding with a particular binding free energy dG. Here is an example that adds a
theophylline binding motif. Free energy contribution of this motif of dG=-9.22kcal/mol is
derived from k_d=0.32umol/l, taken from Jenison et al. 1994. Although the structure motif
consists of a symmetric interior loop of size 6, followed by a small helix of 3 basepairs,
and a bulge of 3 nucleotides, the entire structure can still be represented by one
interior loop. See the below mofif description where the '&' character splits the motif
into a 5' and a 3' part. The first line gives the sequences motif, the second line shows
the actual structure motif of the aptamer pocket, and the third line is the interior loop
motif that fully encapsulates the theophylline aptamer:
GAUACCAG&CCCUUGGCAGC
(...((((&)...)))...)
(......(&).........)
To use the above information in the folding recursions of RNAfold, one only needs to
provide the motif itself, and binding free energy:
$ RNAfold --motif="GAUACCAG&CCCUUGGCAGC,(...((((&)...)))...),-9.22" < sequences.fa
Adding the --verbose option to the above call of RNAfold also prints the sequence position
of each motif found in the MFE structure. In case interior-loop like motifs are provided,
two intervals are printed denoting the 5' and 3' part, respectively.
Ligand binding contributions to unpaired segments of the RNA structure
The extension of the RNA folding grammar with unstructured domains allows for an easy
incorporation of ligands that bind to unpaired stretches of an RNA structure. To model
such interactions only two parameters are required: (i) a sequence motif in IUPAC notation
that specifies where the ligand binds to, and (ii) a binding free energy that can be
derived from the association/dissociation constant of the ligand. With these two
parameters in hand, the modification of RNAfold to include the competition of regular
intramolecular base pairing and ligand interaction is as easy as writing a simple command
file of the form:
UD m e [LOOP]
where m is the motif string in upper-case IUPAC notation, and e the binding free energy in
kcal/mol and optional loop type restriction [LOOP]. See also the command file
specification as defined above.
For instance, having a protein with a 4-nucleotide footprint binding 'AAAA', a binding
free energy e = -5.0 kcal/mol, and a binding restriction to exterior- and multibranch
loops results in a command file:
$ cat commands.txt
UD AAAA -5.0 ME
and the corresponding call to RNAfold to compute MFE and equilibrium probabilities
becomes:
$ RNAfold --commands=commands.txt -p < sequence.fa
The resulting MFE plot will be annotated to display the binding site(s) of the ligand, and
the base pair probability dot-plot is extended to include the probability that a
particular nucleotide is bound by the ligand.
POST-TRANSCRIPTIONAL MODIFICATION EXAMPLES
Many RNA molecules harbor (post-transcriptional) modifications. These modified base often
change the pairing behavior or energy contribution for the loops they are part of. To
accommodate for that effect (to a certain degree) one may use additional correcting energy
parameters for loops with the respective modified bases. In literature, a few stacking-
and some terminal mismatch energies can be found. Some of them are already provided within
the ViennaRNA Package. The --modification and --mod-file command line parameters can be
used to apply these parameters in the predictions. While the former allows one to select a
subset of implemented modified base corrections, the latter enables the prediction
programs to read energy parameters for modified bases from a user-provided JSON file.
Consider, for instance, the following tRNA sequence with dihydrouridines and
pseudouridines annotated by their respective one-letter codes D and P:
$ cat tRNAphe.fa
>tRNAphe
GCCGAAAUAGCUCAGDDGGGAGAGCGPPAGACUGAAGAPCUAAAGGDCCCUGGUPCGAUCCCGGGUUUCGGCACCA
Now, a prediction that includes support for the destabilizing effect of D and the
stabilizing effects of P within base pair stacks can be done as follows:
$ RNAfold --modifications=DP < tRNAphe.fa
>tRNAphe
GCCGAAAUAGCUCAGDDGGGAGAGCGPPAGACUGAAGAPCUAAAGGDCCCUGGUPCGAUCCCGGGUUUCGGCACCA
(((((((..((((........)))).(((((.......)))))....(((.((......)).)))))))))).... (-23.37)
AUTHOR
Ivo L Hofacker, Walter Fontana, Sebastian Bonhoeffer, Peter F Stadler, Ronny Lorenz
REPORTING BUGS
If in doubt our program is right, nature is at fault. Comments should be sent to
rna@tbi.univie.ac.at.