Provided by: trim-galore_0.6.10-1_all 
NAME
trim_galore - automate quality and adapter trimming for DNA sequencing
DESCRIPTION
USAGE:
trim_galore [options] <filename(s)>
-h/--help Print this help message and exits.
-v/--version Print the version information and exits.
-q/--quality <INT> Trim low-quality ends from reads in addition to adapter removal.
For
RRBS samples, quality trimming will be performed first, and adapter
trimming is carried in a second round. Other files are quality and adapter trimmed
in a single pass. The algorithm is the same as the one used by BWA (Subtract INT
from all qualities; compute partial sums from all indices to the end of the
sequence; cut sequence at the index at which the sum is minimal). Default Phred
score: 20.
--phred33 Instructs Cutadapt to use ASCII+33 quality scores as Phred scores
(Sanger/Illumina 1.9+ encoding) for quality trimming. Default: ON.
--phred64 Instructs Cutadapt to use ASCII+64 quality scores as Phred scores
(Illumina 1.5 encoding) for quality trimming.
--fastqc Run FastQC in the default mode on the FastQ file once trimming is
complete.
--fastqc_args "<ARGS>" Passes extra arguments to FastQC. If more than one argument is to
be passed
to FastQC they must be in the form "arg1 arg2 etc.". An example would be:
--fastqc_args "--nogroup --outdir /home/". Passing extra arguments will
automatically invoke FastQC, so --fastqc does not have to be specified separately.
-a/--adapter <STRING> Adapter sequence to be trimmed. If not specified explicitly, Trim
Galore will
try to auto-detect whether the Illumina universal, Nextera transposase or Illumina
small RNA adapter sequence was used. Also see '--illumina', '--nextera' and
'--small_rna'. If no adapter can be detected within the first 1 million sequences
of the first file specified or if there is a tie between several adapter sequences,
Trim Galore defaults to '--illumina' (as long as the Illumina adapter was one of
the options, else '--nextera' is the default). A single base may also be given as
e.g. -a A{10}, to be expanded to -a AAAAAAAAAA.
-a2/--adapter2 <STRING> Optional adapter sequence to be trimmed off read 2 of paired-end
files. This
option requires '--paired' to be specified as well. If the libraries to be trimmed
are smallRNA then a2 will be set to the Illumina small RNA 5' adapter automatically
(GATCGTCGGACT). A single base may also be given as e.g. -a2 A{10}, to be expanded
to -a2 AAAAAAAAAA.
--illumina Adapter sequence to be trimmed is the first 13bp of the Illumina
universal adapter
'AGATCGGAAGAGC' instead of the default auto-detection of adapter sequence.
--nextera Adapter sequence to be trimmed is the first 12bp of the Nextera
adapter
'CTGTCTCTTATA' instead of the default auto-detection of adapter sequence.
--small_rna Adapter sequence to be trimmed is the first 12bp of the Illumina
Small RNA 3' Adapter
'TGGAATTCTCGG' instead of the default auto-detection of adapter sequence. Selecting
to trim smallRNA adapters will also lower the --length value to 18bp. If the
smallRNA libraries are paired-end then a2 will be set to the Illumina small RNA 5'
adapter automatically (GATCGTCGGACT) unless -a 2 had been defined explicitly.
--consider_already_trimmed <INT> During adapter auto-detection, the limit set by <INT>
allows the user to
set a threshold up to which the file is considered already adapter-trimmed. If no adapter
sequence exceeds this threshold, no additional adapter trimming will be performed
(technically, the adapter is set to '-a X'). Quality trimming is still performed as
usual. Default: NOT SELECTED (i.e. normal auto-detection precedence rules apply).
--max_length <INT> Discard reads that are longer than <INT> bp after trimming. This
is only advised for
smallRNA sequencing to remove non-small RNA sequences.
--stringency <INT> Overlap with adapter sequence required to trim a sequence.
Defaults to a
very stringent setting of 1, i.e. even a single bp of overlapping sequence
will be trimmed off from the 3' end of any read.
-e <ERROR RATE> Maximum allowed error rate (no. of errors divided by the length of
the matching
region) (default: 0.1)
--gzip Compress the output file with GZIP. If the input files are
GZIP-compressed
the output files will automatically be GZIP compressed as well. As of v0.2.8 the
compression will take place on the fly.
--dont_gzip Output files won't be compressed with GZIP. This option overrides
--gzip.
--length <INT> Discard reads that became shorter than length INT because of
either
quality or adapter trimming. A value of '0' effectively disables
this behaviour. Default: 20 bp.
For paired-end files, both reads of a read-pair need to be longer than
<INT> bp to be printed out to validated paired-end files (see option --paired). If
only one read became too short there is the possibility of keeping such unpaired
single-end reads (see --retain_unpaired). Default pair-cutoff: 20 bp.
--max_n COUNT The total number of Ns (as integer) a read may contain before it
will be removed altogether.
In a paired-end setting, either read exceeding this limit will result in the entire
pair being removed from the trimmed output files.
--trim-n Removes Ns from either side of the read. This option does
currently not work in RRBS mode.
-o/--output_dir <DIR> If specified all output will be written to this directory instead
of the current
directory. If the directory doesn't exist it will be created for you.
--no_report_file If specified no report file will be generated.
--suppress_warn If specified any output to STDOUT or STDERR will be suppressed.
--clip_R1 <int> Instructs Trim Galore to remove <int> bp from the 5' end of read 1
(or single-end
reads). This may be useful if the qualities were very poor, or if there is some
sort of unwanted bias at the 5' end. Default: OFF.
--clip_R2 <int> Instructs Trim Galore to remove <int> bp from the 5' end of read 2
(paired-end reads
only). This may be useful if the qualities were very poor, or if there is some sort
of unwanted bias at the 5' end. For paired-end BS-Seq, it is recommended to remove
the first few bp because the end-repair reaction may introduce a bias towards low
methylation. Please refer to the M-bias plot section in the Bismark User Guide for
some examples. Default: OFF.
--three_prime_clip_R1 <int> Instructs Trim Galore to remove <int> bp from the 3' end
of read 1 (or single-end
reads) AFTER adapter/quality trimming has been performed. This may remove some unwanted
bias from the 3' end that is not directly related to adapter sequence or basecall
quality. Default: OFF.
--three_prime_clip_R2 <int> Instructs Trim Galore to remove <int> bp from the 3' end
of read 2 AFTER
adapter/quality trimming has been performed. This may remove some unwanted bias from
the 3' end that is not directly related to adapter sequence or basecall quality.
Default: OFF.
--2colour/--nextseq INT This enables the option '--nextseq-trim=3'CUTOFF' within Cutadapt,
which will set a quality
cutoff (that is normally given with -q instead), but qualities of G bases are ignored.
This trimming is in common for the NextSeq- and NovaSeq-platforms, where basecalls
without any signal are called as high-quality G bases. This is mutually exlusive
with '-q INT'.
--path_to_cutadapt </path/to/cutadapt> You may use this option to specify a path to
the Cutadapt executable,
e.g. /my/home/cutadapt-1.7.1/bin/cutadapt. Else it is assumed that Cutadapt is in
the PATH.
--basename <PREFERRED_NAME> Use PREFERRED_NAME as the basename for output files,
instead of deriving the filenames from
the input files. Single-end data would be called PREFERRED_NAME_trimmed.fq(.gz), or
PREFERRED_NAME_val_1.fq(.gz) and PREFERRED_NAME_val_2.fq(.gz) for paired-end data.
--basename only works when 1 file (single-end) or 2 files (paired-end) are
specified, but not for longer lists.
-j/--cores INT Number of cores to be used for trimming [default: 1]. For Cutadapt
to work with multiple cores, it
requires Python 3 as well as parallel gzip (pigz) installed on the system. The version of
Python used
is detected from the shebang line of the Cutadapt executable (either 'cutadapt', or
a specified path). If Python 2 is detected, --cores is set to 1. If pigz cannot
be detected on your system, Trim Galore reverts to using gzip compression. Please
note that gzip compression will slow down multi-core processes so much that it is
hardly worthwhile, please see:
https://github.com/FelixKrueger/TrimGalore/issues/16#issuecomment-458557103 for
more info).
Actual core usage: It should be mentioned that the actual number of cores used is a little
convoluted.
Assuming that Python 3 is used and pigz is installed, --cores 2 would use 2 cores
to read the input (probably not at a high usage though), 2 cores to write to the
output (at moderately high usage), and 2 cores for Cutadapt itself + 2 additional
cores for Cutadapt (not sure what they are used for) + 1 core for Trim Galore
itself. So this can be up to 9 cores, even though most of them won't be used at
100% for most of the time. Paired-end processing uses twice as many cores for the
validation (= writing out) step. --cores 4 would then be: 4 (read) + 4 (write) + 4
(Cutadapt) + 2 (extra Cutadapt) + 1 (Trim Galore) = 15.
It seems that --cores 4 could be a sweet spot, anything above has diminishing
returns.
SPECIFIC TRIMMING - without adapter/quality trimming
--hardtrim5 <int> Instead of performing adapter-/quality trimming, this option will
simply hard-trim sequences
to <int> bp at the 5'-end. Once hard-trimming of files is complete, Trim Galore will exit.
Hard-trimmed output files will end in .<int>_5prime.fq(.gz). Here is an example:
before:
CCTAAGGAAACAAGTACACTCCACACATGCATAAAGGAAATCAAATGTTATTTTTAAGAAAATGGAAAAT
--hardtrim5 20: CCTAAGGAAACAAGTACACT
--hardtrim3 <int> Instead of performing adapter-/quality trimming, this option will
simply hard-trim sequences
to <int> bp at the 3'-end. Once hard-trimming of files is complete, Trim Galore will exit.
Hard-trimmed output files will end in .<int>_3prime.fq(.gz). Here is an example:
before:
CCTAAGGAAACAAGTACACTCCACACATGCATAAAGGAAATCAAATGTTATTTTTAAGAAAATGGAAAAT
--hardtrim3 20:
TTTTTAAGAAAATGGAAAAT
--clock In this mode, reads are trimmed in a specific way that is
currently used for the Mouse
Epigenetic Clock (see here: Multi-tissue DNA methylation age predictor in mouse, Stubbs et
al.,
Genome Biology, 2017 18:68 https://doi.org/10.1186/s13059-017-1203-5). Following
this, Trim Galore will exit.
In it's current implementation, the dual-UMI RRBS reads come in the following
format:
Read 1 5' UUUUUUUU CAGTA FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF TACTG UUUUUUUU 3'
Read 2 3' UUUUUUUU GTCAT FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF ATGAC UUUUUUUU 5'
Where UUUUUUUU is a random 8-mer unique molecular identifier (UMI), CAGTA is a constant
region,
and FFFFFFF... is the actual RRBS-Fragment to be sequenced. The UMIs for Read 1
(R1) and Read 2 (R2), as well as the fixed sequences (F1 or F2), are written into
the read ID and removed from the actual sequence. Here is an example:
R1: @HWI-D00436:407:CCAETANXX:1:1101:4105:1905 1:N:0: CGATGTTT
ATCTAGTTCAGTACGGTGTTTTCGAATTAGAAAAATATGTATAGAGGAAATAGATATAAAGGCGTATTCGTTATTG
R2: @HWI-D00436:407:CCAETANXX:1:1101:4105:1905 3:N:0: CGATGTTT
CAATTTTGCAGTACAAAAATAATACCTCCTCTATTTATCCAAAATCACAAAAAACCACCCACTTAACTTTCCCTAA
R1: @HWI-D00436:407:CCAETANXX:1:1101:4105:1905 1:N:0:
CGATGTTT:R1:ATCTAGTT:R2:CAATTTTG:F1:CAGT:F2:CAGT
CGGTGTTTTCGAATTAGAAAAATATGTATAGAGGAAATAGATATAAAGGCGTATTCGTTATTG
R2: @HWI-D00436:407:CCAETANXX:1:1101:4105:1905 3:N:0:
CGATGTTT:R1:ATCTAGTT:R2:CAATTTTG:F1:CAGT:F2:CAGT
CAAAAATAATACCTCCTCTATTTATCCAAAATCACAAAAAACCACCCACTTAACTTTCCCTAA
Following clock trimming, the resulting files (.clock_UMI.R1.fq(.gz) and
.clock_UMI.R2.fq(.gz))
should be adapter- and quality trimmed with Trim Galore as usual. In addition,
reads need to be trimmed by 15bp from their 3' end to get rid of potential UMI and
fixed sequences. The command is:
trim_galore --paired --three_prime_clip_R1 15 --three_prime_clip_R2 15
*.clock_UMI.R1.fq.gz *.clock_UMI.R2.fq.gz
Following this, reads should be aligned with Bismark and deduplicated with UmiBam
in '--dual_index' mode (see here: https://github.com/FelixKrueger/Umi-Grinder).
UmiBam recognises the UMIs within this pattern: R1:(ATCTAGTT):R2:(CAATTTTG): as
(UMI R1) and (UMI R2).
--polyA This is a new, still experimental, trimming mode to identify and
remove poly-A tails from sequences.
When --polyA is selected, Trim Galore attempts to identify from the first supplied sample
whether
sequences contain more often a stretch of either 'AAAAAAAAAA' or 'TTTTTTTTTT'. This
determines if Read 1 of a paired-end end file, or single-end files, are trimmed for
PolyA or PolyT. In case of paired-end sequencing, Read2 is trimmed for the
complementary base from the start of the reads. The auto-detection uses a default
of A{20} for Read1 (3'-end trimming) and T{150} for Read2 (5'-end trimming). These
values may be changed manually using the options -a and -a2.
In addition to trimming the sequences, white spaces are replaced with _ and it records in
the read ID
how many bases were trimmed so it can later be used to identify PolyA trimmed
sequences. This is currently done by writing tags to both the start ("32:A:") and
end ("_PolyA:32") of the reads in the following example:
@READ-ID:1:1102:22039:36996 1:N:0:CCTAATCC
GCCTAAGGAAACAAGTACACTCCACACATGCATAAAGGAAATCAAATGTTATTTTTAAGAAAATGGAAAATAAAAACTTTATAAACACCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
@32:A:READ-ID:1:1102:22039:36996_1:N:0:CCTAATCC_PolyA:32
GCCTAAGGAAACAAGTACACTCCACACATGCATAAAGGAAATCAAATGTTATTTTTAAGAAAATGGAAAATAAAAACTTTATAAACACC
PLEASE NOTE: The poly-A trimming mode expects that sequences were both adapter and quality
trimmed
before looking for Poly-A tails, and it is the user's responsibility to carry out
an initial round of trimming. The following sequence:
1) trim_galore file.fastq.gz
2) trim_galore --polyA file_trimmed.fq.gz 3) zcat file_trimmed_trimmed.fq.gz | grep
-A 3 PolyA | grep -v ^-- > PolyA_trimmed.fastq
Will 1) trim qualities and Illumina adapter contamination, 2) find and remove PolyA
contamination.
Finally, if desired, 3) will specifically find PolyA trimmed sequences to a
specific FastQ file of your choice.
--implicon This is a special mode of operation for paired-end data, such as
required for the IMPLICON method, where a UMI sequence
is getting transferred from the start of Read 2 to the readID of both reads.
Following this, Trim Galore will exit.
In it's current implementation, the UMI carrying reads come in the following
format:
Read 1 5' FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF 3'
Read 2 3' UUUUUUUUFFFFFFFFFFFFFFFFFFFFFFFFFFFF 5'
Where UUUUUUUU is a random 8-mer unique molecular identifier (UMI) and FFFFFFF... is the
actual fragment to be
sequenced. The UMI of Read 2 (R2) is written into the read ID of both reads and
removed from the actual sequence. Here is an example:
R1: @HWI-D00436:407:CCAETANXX:1:1101:4105:1905 1:N:0: CGATGTTT
ATCTAGTTCAGTACGGTGTTTTCGAATTAGAAAAATATGTATAGAGGAAATAGATATAAAGGCGTATTCGTTATTG
R2: @HWI-D00436:407:CCAETANXX:1:1101:4105:1905 3:N:0: CGATGTTT
CAATTTTGCAGTACAAAAATAATACCTCCTCTATTTATCCAAAATCACAAAAAACCACCCACTTAACTTTCCCTAA
After --implicon trimming:
R1: @HWI-D00436:407:CCAETANXX:1:1101:4105:1905 1:N:0: CGATGTTT:CAATTTTG
ATCTAGTTCAGTACGGTGTTTTCGAATTAGAAAAATATGTATAGAGGAAATAGATATAAAGGCGTATTCGTTATTG
R2: @HWI-D00436:407:CCAETANXX:1:1101:4105:1905 3:N:0: CGATGTTT:CAATTTTG
CAGTACAAAAATAATACCTCCTCTATTTATCCAAAATCACAAAAAACCACCCACTTAACTTTCCCTAA
RRBS-specific options (MspI digested material):
--rrbs Specifies that the input file was an MspI digested RRBS sample
(recognition
site: CCGG). Single-end or Read 1 sequences (paired-end) which were adapter-trimmed
will have a further 2 bp removed from their 3' end. Sequences which were merely
trimmed because of poor quality will not be shortened further. Read 2 of paired-end
libraries will in addition have the first 2 bp removed from the 5' end (by setting
'--clip_r2 2'). This is to avoid using artificial methylation calls from the
filled-in cytosine positions close to the 3' MspI site in sequenced fragments.
This option is not recommended for users of the NuGEN ovation RRBS System 1-16 kit
(see below).
--non_directional Selecting this option for non-directional RRBS libraries will
screen
quality-trimmed sequences for 'CAA' or 'CGA' at the start of the read
and, if found, removes the first two basepairs. Like with the option '--rrbs' this
avoids using cytosine positions that were filled-in during the end-repair step.
'--non_directional' requires '--rrbs' to be specified as well. Note that this
option does not set '--clip_r2 2' in paired-end mode.
--keep Keep the quality trimmed intermediate file. Default: off, which
means
the temporary file is being deleted after adapter trimming. Only has
an effect for RRBS samples since other FastQ files are not trimmed for poor
qualities separately.
Note for RRBS using the NuGEN Ovation RRBS System 1-16 kit:
Owing to the fact that the NuGEN Ovation kit attaches a varying number of nucleotides
(0-3) after each MspI site Trim Galore should be run WITHOUT the option --rrbs. This
trimming is accomplished in a subsequent diversity trimming step afterwards (see their
manual).
Note for RRBS using MseI:
If your DNA material was digested with MseI (recognition motif: TTAA) instead of MspI it
is NOT necessary to specify --rrbs or --non_directional since virtually all reads should
start with the sequence 'TAA', and this holds true for both directional and
non-directional libraries. As the end-repair of 'TAA' restricted sites does not involve
any cytosines it does not need to be treated especially. Instead, simply run Trim Galore!
in the standard (i.e. non-RRBS) mode.
Paired-end specific options:
--paired This option performs length trimming of quality/adapter/RRBS
trimmed reads for
paired-end files. To pass the validation test, both sequences of a sequence pair
are required to have a certain minimum length which is governed by the option
--length (see above). If only one read passes this length threshold the other read
can be rescued (see option --retain_unpaired). Using this option lets you discard
too short read pairs without disturbing the sequence-by-sequence order of FastQ
files which is required by many aligners.
Trim Galore! expects paired-end files to be supplied in a pairwise fashion, e.g.
file1_1.fq file1_2.fq SRR2_1.fq.gz SRR2_2.fq.gz ... .
-t/--trim1 Trims 1 bp off every read from its 3' end. This may be needed for
FastQ files that
are to be aligned as paired-end data with Bowtie. This is because Bowtie (1) regards
alignments like this:
R1 --------------------------->
or this: -----------------------> R1
R2 <---------------------------
<----------------- R2
as invalid (whenever a start/end coordinate is contained within the other read).
NOTE: If you are planning to use Bowtie2, BWA etc. you don't need to specify this
option.
--retain_unpaired If only one of the two paired-end reads became too short, the
longer
read will be written to either '.unpaired_1.fq' or '.unpaired_2.fq'
output files. The length cutoff for unpaired single-end reads is governed by the
parameters -r1/--length_1 and -r2/--length_2. Default: OFF.
-r1/--length_1 <INT> Unpaired single-end read length cutoff needed for read 1 to be
written to
'.unpaired_1.fq' output file. These reads may be mapped in single-end mode.
Default: 35 bp.
-r2/--length_2 <INT> Unpaired single-end read length cutoff needed for read 2 to be
written to
'.unpaired_2.fq' output file. These reads may be mapped in single-end mode.
Default: 35 bp.
Last modified on 07 October 2020.
AUTHOR
This manpage was written by Nilesh Patra for the Debian distribution and
can be used for any other usage of the program.