Provided by: sambamba_1.0.1+dfsg-2ubuntu1_amd64 bug

NAME

       sambamba-view - tool for extracting information from SAM/BAM files

SYNOPSIS

       sambamba view OPTIONS <input.bam | input.sam> [region1 [...]]

DESCRIPTION

       sambamba view allows to efficiently filter SAM/BAM files for alignments satisfying various conditions, as
       well  as  access  its  SAM  header and information about reference sequences. In order to make these data
       readily available for consumption by scripts in Perl/Python/Ruby, JSON output is provided.

       By default, the tool expects BAM file as an input. In order to work with SAM, specify -S|--sam-input as a
       command-line option, the tool does NOT try to guess file format from  the  extension.  Beware  that  when
       reading  SAM,  the  tool will skip tags which don´t conform to the SAM/BAM specification, and set invalid
       fields to their default values.

FILTERING

       Filtering is presented in two ways. First, you can specify a condition with -F option,  using  a  special
       language for filtering, described at

       https://github.com/lomereiter/sambamba/wiki/%5Bsambamba-view%5D-Filter-expression-syntax

       Second, if you have an indexed BAM file, several regions can be specified as well. The syntax for regions
       is  the  same  as  in  samtools:  chr:beg-end where beg and end are 1-based start and end of a closed-end
       interval on the reference chr.

JSON

       Alignment record JSON representation is a  hash  with  keys  ´qname´,  ´flag´,  ´rname´,  ´pos´,  ´mapq´,
       ´cigar´, ´rnext´, ´qual´, ´tags´, e.g.

       {"qname":"EAS56_57:6:190:289:82","flag":69,"rname":"chr1","pos":100,
       "mapq":0,"cigar":"*","rnext":"=","pnext":100,"tlen":0,
       "seq":"CTCAAGGTTGTTGCAAGGGGGTCTATGTGAACAAA",
       "qual":[27,27,27,22,27,27,27,26,27,27,27,27,27,27,27,27,23,26,26,27,
       22,26,19,27,26,27,26,26,26,26,26,24,19,27,26],"tags":{"MF":192}}

       JSON representation mimics SAM format except quality is given as an array of integers.

       Postprocessing JSON output is best accomplished with https://stedolan.github.io/jq/

       The output is one line per read, for building a proper JSON array pipe the output into jq --slurp.

OPTIONS

       -F, --filter=FILTER
              Set custom filter for alignments.

       -f, --format=FORMAT
              Specify output format. FORMAT must be one of sam, bam, or json (in lowercase). Default is SAM.

       -h, --with-header
              Print SAM header before reads. This is always done for BAM output.

       -H, --header
              Print  only  SAM header to STDOUT. If FORMAT is sam or bam, its text version is printed, otherwise
              JSON object is written.

       -I, --reference-info
              Output to STDOUT reference sequence names and lengths in JSON (see EXAMPLES).

       -L, --regions=BEDFILE
              Intersect a file with regions specified in the BED file.

       -c, --count
              Output to STDOUT only the number of matching records, -hHI options are ignored.

       -v, --valid
              Output only valid reads.

       -S, --sam-input
              Specify that the input is SAM file (default is BAM for all operations).

       -p, --show-progress
              Show progressbar in STDERR. Works only for BAM files, and with no  regions  specified,  i.e.  only
              when reading full file.

       -l, --compression-level=COMPRESSION_LEVEL
              Set compression level for BAM output, a number from 0 to 9.

       -o, --output-filename=FILENAME
              Specify output filename (by default everything is written to STDOUT).

       -t, --nthreads=NTHREADS
              Number of threads to use.

EXAMPLES

       Print basic reference sequence information:

            $ sambamba view --reference-info ex1_header.bam
            [{"name":"chr1","length":1575},{"name":"chr2","length":1584}]

       Count reads with mapping quality not less than 50:

            $ sambamba view -c -F "mapping_quality >= 50" ex1_header.bam
            3124

       Count properly paired reads overlapping 100..200 on chr1:

            $ sambamba view -c -F "proper_pair" ex1_header.bam chr1:100-200
            39

       Output header in JSON format:

            $ sambamba view --header --format=json ex1_header.bam
            {"format_version":"1.3","rg_lines":[],
             "sq_lines":[{"sequence_length":1575,"species":"","uri":"",
             "sequence_name":"chr1","assembly":"","md5":""},
             {"sequence_length":1584,"species":"","uri":"",
             "sequence_name":"chr2","assembly":"","md5":""}],
             "sorting_order":"coordinate","pg_lines":[]}

SEE ALSO

       For  more  information  on  the  original  samtools  VIEW behaviour, check out the samtools documentation
       http://samtools.sourceforge.net/samtools.shtml.

                                                    June 2016                                   SAMBAMBA-VIEW(1)