Provided by: libbio-perl-perl_1.6.923-1_all bug

NAME

       Bio::Tools::Run::StandAloneNCBIBlast - Object for the local execution of the NCBI BLAST program suite
       (blastall, blastpgp, bl2seq). With experimental support for NCBI rpsblast.

SYNOPSIS

        # Do not use directly; see Bio::Tools::Run::StandAloneBlast

DESCRIPTION

       See Bio::Tools::Run::StandAloneBlast

FEEDBACK

   Mailing Lists
       User feedback is an integral part of the evolution of this and other Bioperl modules. Send your comments
       and suggestions preferably to one of the Bioperl mailing lists.  Your participation is much appreciated.

         bioperl-l@bioperl.org                  - General discussion
         http://bioperl.org/wiki/Mailing_lists  - About the mailing lists

   Support
       Please direct usage questions or support issues to the mailing list:

       bioperl-l@bioperl.org

       rather than to the module maintainer directly. Many experienced and reponsive experts will be able look
       at the problem and quickly address it. Please include a thorough description of the problem with code and
       data examples if at all possible.

   Reporting Bugs
       Report bugs to the Bioperl bug tracking system to help us keep track the bugs and their resolution.  Bug
       reports can be submitted via the web:

         https://redmine.open-bio.org/projects/bioperl/

AUTHOR - Peter Schattner

       Email schattner at alum.mit.edu

MAINTAINER - Torsten Seemann

       Email torsten at infotech.monash.edu.au

CONTRIBUTORS

       Sendu Bala  bix@sendu.me.uk (reimplementation)

APPENDIX

       The rest of the documentation details each of the object methods. Internal methods are usually preceded
       with a _

   new
        Title   : new
        Usage   : my $obj = Bio::Tools::Run::StandAloneBlast->new();
        Function: Builds a newBio::Tools::Run::StandAloneBlast object
        Returns : Bio::Tools::Run::StandAloneBlast
        Args    : -quiet => boolean # make program execution quiet
                  -_READMETHOD => 'BLAST' (default, synonym 'SearchIO') || 'blast_pull'
                                  # the parsing method, case insensitive

       Essentially all BLAST parameters can be set via StandAloneBlast.pm.  Some of the most commonly used
       parameters are listed below. All parameters have defaults and are optional except for -p in those
       programs that have it. For a complete listing of settable parameters, run the relevant executable BLAST
       program with the option "-" as in blastall - Note that the input parameters (-i, -j, -input) should not
       be set directly by you: this module sets them when you call one of the executable methods.

       Blastall

         -p  Program Name [String]
               Input should be one of "blastp", "blastn", "blastx",
               "tblastn", or "tblastx".
         -d  Database [String] default = nr
               The database specified must first be formatted with formatdb.
               Multiple database names (bracketed by quotations) will be accepted.
               An example would be -d "nr est"
         -e  Expectation value (E) [Real] default = 10.0
         -o  BLAST report Output File [File Out]  Optional,
                   default = ./blastreport.out ; set by StandAloneBlast.pm
         -S  Query strands to search against database (for blast[nx], and tblastx). 3 is both, 1 is top, 2 is bottom [Integer]
                   default = 3

       Blastpgp (including Psiblast)

         -j  is the maximum number of rounds (default 1; i.e., regular BLAST)
         -h  is the e-value threshold for including sequences in the
                   score matrix model (default 0.001)
         -c  is the "constant" used in the pseudocount formula specified in the paper (default 10)
         -B  Multiple alignment file for PSI-BLAST "jump start mode"  Optional
         -Q  Output File for PSI-BLAST Matrix in ASCII [File Out]  Optional

       rpsblast

         -d  Database [String] default = (none - you must specify a database)
               The database specified must first be formatted with formatdb.
               Multiple database names (bracketed by quotations) will be accepted.
               An example would be -d "Cog Smart"
         -e  Expectation value (E) [Real] default = 10.0
         -o  BLAST report Output File [File Out]  Optional,
                   default = ./blastreport.out ; set by StandAloneBlast.pm

       Bl2seq

         -p  Program name: blastp, blastn, blastx. For blastx 1st argument should be nucleotide [String]
           default = blastp
         -o  alignment output file [File Out] default = stdout
         -e  Expectation value (E) [Real]  default = 10.0
         -S  Query strands to search against database (blastn only).  3 is both, 1 is top, 2 is bottom [Integer]
           default = 3

   blastall
        Title   : blastall
        Usage   :  $blast_report = $factory->blastall('t/testquery.fa');
               or
                      $input = Bio::Seq->new(-id=>"test query",
                                             -seq=>"ACTACCCTTTAAATCAGTGGGGG");
                      $blast_report = $factory->blastall($input);
               or
                     $seq_array_ref = \@seq_array;
                # where @seq_array is an array of Bio::Seq objects
                     $blast_report = $factory->blastall($seq_array_ref);
        Returns : Reference to a Blast object containing the blast report.
        Args    : Name of a file or Bio::Seq object or an array of
                  Bio::Seq object containing the query sequence(s).
                  Throws an exception if argument is not either a string
                  (eg a filename) or a reference to a Bio::Seq object
                  (or to an array of Seq objects).  If argument is string,
                  throws exception if file corresponding to string name can
                  not be found.

   blastpgp
        Title   : blastpgp
        Usage   :  $blast_report = $factory-> blastpgp('t/testquery.fa');
               or
                      $input = Bio::Seq->new(-id=>"test query",
                                             -seq=>"ACTADDEEQQPPTCADEEQQQVVGG");
                      $blast_report = $factory->blastpgp ($input);
               or
                     $seq_array_ref = \@seq_array;
                # where @seq_array is an array of Bio::Seq objects
                     $blast_report = $factory-> blastpgp(\@seq_array);
        Returns : Reference to a Bio::SearchIO object containing the blast report
        Args    : Name of a file or Bio::Seq object. In psiblast jumpstart
                  mode two additional arguments are required: a SimpleAlign
                  object one of whose elements is the query and a "mask" to
                  determine how BLAST should select scoring matrices see
                  DESCRIPTION above for more details.

                  Throws an exception if argument is not either a string
                  (eg a filename) or a reference to a Bio::Seq object
                  (or to an array of Seq objects).  If argument is string,
                  throws exception if file corresponding to string name can
                  not be found.
        Returns : Reference to Bio::SearchIO object containing the blast report.

   rpsblast
        Title   : rpsblast
        Usage   :  $blast_report = $factory->rpsblast('t/testquery.fa');
               or
                      $input = Bio::Seq->new(-id=>"test query",
                                             -seq=>"MVVLCRADDEEQQPPTCADEEQQQVVGG");
                      $blast_report = $factory->rpsblast($input);
               or
                     $seq_array_ref = \@seq_array;
                # where @seq_array is an array of Bio::Seq objects
                     $blast_report = $factory->rpsblast(\@seq_array);
        Args    : Name of a file or Bio::Seq object or an array of
                  Bio::Seq object containing the query sequence(s).
                  Throws an exception if argument is not either a string
                  (eg a filename) or a reference to a Bio::Seq object
                  (or to an array of Seq objects).  If argument is string,
                  throws exception if file corresponding to string name can
                  not be found.
        Returns : Reference to a Bio::SearchIO object containing the blast report

   bl2seq
        Title   : bl2seq
        Usage   : $factory-> bl2seq('t/seq1.fa', 't/seq2.fa');
               or
                 $input1 = Bio::Seq->new(-id=>"test query1",
                                         -seq=>"ACTADDEEQQPPTCADEEQQQVVGG");
                 $input2 = Bio::Seq->new(-id=>"test query2",
                                         -seq=>"ACTADDEMMMMMMMDEEQQQVVGG");
                 $blast_report = $factory->bl2seq ($input1,  $input2);
        Returns : Reference to a BPbl2seq object containing the blast report.
        Args    : Names of 2 files  or 2 Bio::Seq objects containing the
                  sequences to be aligned by bl2seq.

                  Throws an exception if argument is not either a pair of
                  strings (eg filenames) or references to Bio::Seq objects.
                  If arguments are strings, throws exception if files
                  corresponding to string names can not be found.

   _generic_local_blast
        Title   : _generic_local_blast
        Usage   : internal function not called directly
        Returns : Bio::SearchIO
        Args    : Reference to calling object and name of BLAST executable

   _runblast
        Title   :  _runblast
        Usage   :  Internal function, not to be called directly
        Function:   makes actual system call to Blast program
        Example :
        Returns : Report Bio::SearchIO object in the appropriate format
        Args    : Reference to calling object, name of BLAST executable,
                  and parameter string for executable

   _setparams
        Title   : _setparams
        Usage   : Internal function, not to be called directly
        Function: Create parameter inputs for Blast program
        Example :
        Returns : parameter string to be passed to Blast
        Args    : Reference to calling object and name of BLAST executable

perl v5.18.2                                       2014-01-18             Bio::Tools::Run...dAloneNCBIBlast(3pm)