NAME

       Bio::SeqFeature::SubSeq - Feature representing a subsequence

SYNOPSIS

         # SubSeq with implicit sequence
         use Bio::Seq;
         my $template = Bio::Seq->new( -seq => 'AAAAACCCCCGGGGGTTTTT' );
         $subseq = Bio::SeqFeature::Amplicon->new(
             -start    => 6,
             -end      => 15,
             -template => $template,
         );
         print "Subsequence is: ".$amplicon->seq->seq."\n"; # Should be 'CCCCCGGGGG'

         # SubSeq with explicit sequence
         use Bio::SeqFeature::Subseq;
         my $subseq = Bio::SeqFeature::Amplicon->new(
             -seq => $seq_object,
         );

DESCRIPTION

       Bio::SeqFeature::SubSeq extends Bio::SeqFeature::Generic features to represent a
       subsequence. When this feature is attached to a template sequence, the sequence of feature
       is the subsequence of the template at this location. The purpose of this class is to
       represent a sequence as a feature without having to explictly store its sequence string.

       Of course, you might have reasons to explicitly set a sequence. In that case, note that
       the length of the sequence is allowed to not match the position of the feature. For
       example, you can set sequence of length 10 in a SubSeq feature that spans positions 30 to
       50 of the template if you so desire.

FEEDBACK

   Mailing Lists
       User feedback is an integral part of the evolution of this and other Bioperl modules. Send
       your comments and suggestions preferably to one of the Bioperl mailing lists.  Your
       participation is much appreciated.

         bioperl-l@bioperl.org                  - General discussion
         http://bioperl.org/wiki/Mailing_lists  - About the mailing lists

   Support
       Please direct usage questions or support issues to the mailing list:

       bioperl-l@bioperl.org

       rather than to the module maintainer directly. Many experienced and reponsive experts will
       be able look at the problem and quickly address it. Please include a thorough description
       of the problem with code and data examples if at all possible.

   Reporting Bugs
       Report bugs to the Bioperl bug tracking system to help us keep track the bugs and their
       resolution.  Bug reports can be submitted via the web:

         https://redmine.open-bio.org/projects/bioperl/

AUTHOR

       Florent Angly <florent.angly@gmail.com>

APPENDIX

       The rest of the documentation details each of the object methods. Internal methods are
       usually preceded with a _

   new
        Title   : new()
        Usage   : my $subseq = Bio::SeqFeature::SubSeq( -start => 1, -end => 10, -strand => -1);
        Function: Instantiate a new Bio::SeqFeature::SubSeq feature object
        Args    : -seq      , the sequence object or sequence string of the feature (optional)
                  -template , attach the feature to the provided parent template sequence or feature (optional).
                              Note that you must specify the feature location to do this.
                  -start, -end, -location, -strand and all other L<Bio::SeqFeature::Generic> argument can be used.
        Returns : A Bio::SeqFeature::SubSeq object

   seq
        Title   : seq()
        Usage   : my $seq = $subseq->seq();
        Function: Get or set the sequence object of this SubSeq feature. If no sequence
                  was provided, but the subseq is attached to a sequence, get the
                  corresponding subsequence.
        Returns : A sequence object or undef
        Args    : None.

   length
        Title   : seq()
        Usage   : my $length = $subseq->seq();
        Function: Get the length of the SubSeq feature. It is similar to the length()
                  method of L<Bio::Generic::SeqFeature>, which computes length based
                  on the location of the feature. However, if the feature was not
                  given a location, return the length of the subsequence if possible.
        Returns : integer or undef
        Args    : None.