NAME

       Bio::Tools::Run::StandAloneWUBlast - Object for the local execution of WU-Blast.

SYNOPSIS

        # Do not use directly; use Bio::Tools::Run::StandAloneBlast

DESCRIPTION

       See Bio::Tools::Run::StandAloneBlast

FEEDBACK

   Mailing Lists
       User feedback is an integral part of the evolution of this and other Bioperl modules. Send
       your comments and suggestions preferably to one of the Bioperl mailing lists.  Your
       participation is much appreciated.

         bioperl-l@bioperl.org                  - General discussion
         http://bioperl.org/wiki/Mailing_lists  - About the mailing lists

   Support
       Please direct usage questions or support issues to the mailing list:

       bioperl-l@bioperl.org

       rather than to the module maintainer directly. Many experienced and reponsive experts will
       be able look at the problem and quickly address it. Please include a thorough description
       of the problem with code and data examples if at all possible.

   Reporting Bugs
       Report bugs to the Bioperl bug tracking system to help us keep track the bugs and their
       resolution.  Bug reports can be submitted via the web:

         https://redmine.open-bio.org/projects/bioperl/

AUTHOR - Peter Schattner

       Email schattner at alum.mit.edu

MAINTAINER - Torsten Seemann

       Email torsten at infotech.monash.edu.au

CONTRIBUTORS

       Sendu Bala  bix@sendu.me.uk (reimplementation)

APPENDIX

       The rest of the documentation details each of the object methods. Internal methods are
       usually preceded with a _

   new
        Title   : new
        Usage   : my $obj = Bio::Tools::Run::StandAloneBlast->new();
        Function: Builds a newBio::Tools::Run::StandAloneBlast object
        Returns : Bio::Tools::Run::StandAloneBlast
        Args    : -quiet => boolean # make program execution quiet
                  -_READMETHOD => 'BLAST' (default, synonym 'SearchIO') || 'blast_pull'
                                  # the parsing method, case insensitive

       Essentially all BLAST parameters can be set via StandAloneBlast.pm.  Some of the most
       commonly used parameters are listed below. All parameters have defaults and are optional
       except for -p.

         -p Program Name [String]
               Input should be one of "wublastp", "wublastn", "wublastx",
               "wutblastn", or "wutblastx".
         -d  Database [String] default = nr
               The database specified must first be formatted with xdformat.
         -E  Expectation value (E) [Real] default = 10.0
         -o  BLAST report Output File [File Out]  Optional,
                   default = ./blastreport.out ; set by StandAloneBlast.pm

   wublast
        Title   : wublast
        Usage   :  $blast_report = $factory->wublast('t/testquery.fa');
               or
                      $input = Bio::Seq->new(-id=>"test query",
                                             -seq=>"ACTACCCTTTAAATCAGTGGGGG");
                      $blast_report = $factory->wublast($input);
               or
                     $seq_array_ref = \@seq_array;  # where @seq_array is an array of Bio::Seq objects
                     $blast_report = $factory->wublast(\@seq_array);
        Returns :  Reference to a Blast object
        Args    : Name of a file or Bio::Seq object or an array of
                  Bio::Seq object containing the query sequence(s).
                  Throws an exception if argument is not either a string
                  (eg a filename) or a reference to a Bio::Seq object
                  (or to an array of Seq objects).  If argument is string,
                  throws exception if file corresponding to string name can
                  not be found.

   _generic_local_wublast
        Title   : _generic_local_wublast
        Usage   :  internal function not called directly
        Returns :  Blast object
        Args    :   Reference to calling object and name of BLAST executable

   _runwublast
        Title   :  _runwublast
        Usage   :  Internal function, not to be called directly
        Function:   makes actual system call to WU-Blast program
        Example :
        Returns : Report Blast object
        Args    : Reference to calling object, name of BLAST executable,
                  and parameter string for executable

   _setparams
        Title   : _setparams
        Usage   : Internal function, not to be called directly
        Function: Create parameter inputs for Blast program
        Example :
        Returns : parameter string to be passed to Blast
        Args    : Reference to calling object and name of BLAST executable