Provided by: fastx-toolkit_0.0.14-1build1_amd64 bug

NAME

       fastx_barcode_splitter.pl - FASTX Barcode Splitter

DESCRIPTION

       Barcode Splitter, by Assaf Gordon (gordon@cshl.edu), 11sep2008

       This  program  reads  FASTA/FASTQ  file and splits it into several smaller files, Based on
       barcode matching.  FASTA/FASTQ data is read from STDIN (format is auto-detected.)   Output
       files will be writen to disk.  Summary will be printed to STDOUT.

       usage: r.pl --bcfile FILE --prefix PREFIX [--suffix SUFFIX] [--bol|--eol]

              [--mismatches N] [--exact] [--partial N] [--help] [--quiet] [--debug]

       Arguments:

       --bcfile  FILE    -  Barcodes  file name. (see explanation below.)  --prefix PREFIX - File
       prefix. will be added to the output files. Can be used

              to specify output directories.

       --suffix SUFFIX - File suffix (optional). Can be used to specify file

              extensions.

       --bol           - Try to match barcodes at the BEGINNING of sequences.

              (What biologists would call the 5' end, and programmers would call index 0.)

       --eol           - Try to match barcodes at the END of sequences.

              (What biologists would call the 3' end, and programmers would call the end  of  the
              string.)  NOTE: one of --bol, --eol must be specified, but not both.

       --mismatches N  - Max. number of mismatches allowed. default is 1.  --exact         - Same
       as '--mismatches 0'. If both --exact and --mismatches

              are specified, '--exact' takes precedence.

       --partial N     - Allow partial overlap of barcodes. (see explanation below.)

              (Default is not partial matching)

       --quiet         - Don't print counts and summary at the end of the run.

              (Default is to print.)

       --debug         - Print lots of useless debug information to  STDERR.   --help           -
       This helpful help screen.

       Example (Assuming 's_2_100.txt' is a FASTQ file, 'mybarcodes.txt' is the barcodes file):

              $  cat s_2_100.txt | /build/fastx-toolkit-V6DvdY/fastx-toolkit-0.0.14/debian/fastx-
              toolkit/usr/bin/fastx_barcode_splitter.pl     --bcfile     mybarcodes.txt     --bol
              --mismatches 2 \

       --prefix /tmp/bla_ --suffix ".txt"

       Barcode  file  format  -------------------  Barcode files are simple text files. Each line
       should contain an identifier (descriptive name for the barcode), and  the  barcode  itself
       (A/C/G/T), separated by a TAB character. Example:

              #This line is a comment (starts with a 'number' sign) BC1 GATCT BC2 ATCGT BC3 GTGAT
              BC4 TGTCT

       For each barcode, a new FASTQ file will be created (with the barcode's identifier as  part
       of the file name). Sequences matching the barcode will be stored in the appropriate file.

       Running  the  above  example (assuming "mybarcodes.txt" contains the above barcodes), will
       create the following files:

              /tmp/bla_BC1.txt      /tmp/bla_BC2.txt      /tmp/bla_BC3.txt       /tmp/bla_BC4.txt
              /tmp/bla_unmatched.txt

       The 'unmatched' file will contain all sequences that didn't match any barcode.

       Barcode matching ----------------

       ** Without partial matching:

       Count  mismatches  between  the  FASTA/Q  sequences  and  the barcodes.  The barcode which
       matched with the lowest mismatches count  (providing  the  count  is  small  or  equal  to
       '--mismatches N') 'gets' the sequences.

       Example (using the above barcodes): Input Sequence:

              GATTTACTATGTAAAGATAGAAGGAATAAGGTGAAG

   Matching with '--bol --mismatches 1':
              GATTTACTATGTAAAGATAGAAGGAATAAGGTGAAG  GATCT  (1 mismatch, BC1) ATCGT (4 mismatches,
              BC2) GTGAT (3 mismatches, BC3) TGTCT (3 mismatches, BC4)

       This sequence will be classified  as  'BC1'  (it  has  the  lowest  mismatch  count).   If
       '--exact'  or  '--mismatches  0'  were  specified,  this  sequence  would be classified as
       'unmatched' (because, although BC1 had the lowest mismatch count, it is above the  maximum
       allowed mismatches).

       Matching  with  '--eol'  (end  of  line)  does  the  same,  but from the other side of the
       sequence.

       ** With partial matching (very similar to indels):

       Same as above, with the following addition: barcodes are also checked for partial  overlap
       (number of allowed non-overlapping bases is '--partial N').

       Example:  Input  sequence  is ATTTACTATGTAAAGATAGAAGGAATAAGGTGAAG (Same as above, but note
       the missing 'G' at the beginning.)

   Matching (without partial overlapping) against BC1 yields 4 mismatches:
              ATTTACTATGTAAAGATAGAAGGAATAAGGTGAAG GATCT (4 mismatches)

   Partial overlapping would also try the following match:
       -ATTTACTATGTAAAGATAGAAGGAATAAGGTGAAG

              GATCT (1 mismatch)

       Note: scoring counts a missing base as a mismatch, so the final mismatch  count  is  2  (1
       'real'  mismatch,  1  'missing base' mismatch).  If running with '--mismatches 2' (meaning
       allowing upto 2 mismatches) - this seqeunce will be classified as BC1.

SEE ALSO

       The quality of  this  automatically  generated  manpage  might  be  insufficient.   It  is
       suggested to visit

              http://hannonlab.cshl.edu/fastx_toolkit/commandline.html

       to get a better layout as well as an overview about connected FASTX tools.