NAME

       fastx_barcode_splitter.pl - FASTX Barcode Splitter

DESCRIPTION

       Barcode Splitter, by Assaf Gordon (gordon@cshl.edu), 11sep2008

       This  program reads FASTA/FASTQ file and splits it into several smaller files, Based on barcode matching.
       FASTA/FASTQ data is read from STDIN (format is auto-detected.)  Output files  will  be  writen  to  disk.
       Summary will be printed to STDOUT.

       usage: r.pl --bcfile FILE --prefix PREFIX [--suffix SUFFIX] [--bol|--eol]

              [--mismatches N] [--exact] [--partial N] [--help] [--quiet] [--debug]

       Arguments:

       --bcfile  FILE    -  Barcodes file name. (see explanation below.)  --prefix PREFIX - File prefix. will be
       added to the output files. Can be used

              to specify output directories.

       --suffix SUFFIX - File suffix (optional). Can be used to specify file

              extensions.

       --bol           - Try to match barcodes at the BEGINNING of sequences.

              (What biologists would call the 5' end, and programmers would call index 0.)

       --eol           - Try to match barcodes at the END of sequences.

              (What biologists would call the 3' end, and programmers would call the end of the string.)   NOTE:
              one of --bol, --eol must be specified, but not both.

       --mismatches  N   -  Max.  number  of  mismatches  allowed.  default  is  1.   --exact          - Same as
       '--mismatches 0'. If both --exact and --mismatches

              are specified, '--exact' takes precedence.

       --partial N     - Allow partial overlap of barcodes. (see explanation below.)

              (Default is not partial matching)

       --quiet         - Don't print counts and summary at the end of the run.

              (Default is to print.)

       --debug         - Print lots of useless debug information to STDERR.  --help          - This helpful help
       screen.

       Example (Assuming 's_2_100.txt' is a FASTQ file, 'mybarcodes.txt' is the barcodes file):

              $     cat     s_2_100.txt     |     /build/fastx-toolkit-V6DvdY/fastx-toolkit-0.0.14/debian/fastx-
              toolkit/usr/bin/fastx_barcode_splitter.pl --bcfile mybarcodes.txt --bol --mismatches 2 \

       --prefix /tmp/bla_ --suffix ".txt"

       Barcode  file format ------------------- Barcode files are simple text files. Each line should contain an
       identifier (descriptive name for the barcode), and the barcode  itself  (A/C/G/T),  separated  by  a  TAB
       character. Example:

              #This line is a comment (starts with a 'number' sign) BC1 GATCT BC2 ATCGT BC3 GTGAT BC4 TGTCT

       For  each  barcode,  a  new FASTQ file will be created (with the barcode's identifier as part of the file
       name). Sequences matching the barcode will be stored in the appropriate file.

       Running the above example (assuming "mybarcodes.txt"  contains  the  above  barcodes),  will  create  the
       following files:

              /tmp/bla_BC1.txt /tmp/bla_BC2.txt /tmp/bla_BC3.txt /tmp/bla_BC4.txt /tmp/bla_unmatched.txt

       The 'unmatched' file will contain all sequences that didn't match any barcode.

       Barcode matching ----------------

       ** Without partial matching:

       Count  mismatches  between  the  FASTA/Q  sequences and the barcodes.  The barcode which matched with the
       lowest mismatches count (providing the count is small or equal to '--mismatches N') 'gets' the sequences.

       Example (using the above barcodes): Input Sequence:

              GATTTACTATGTAAAGATAGAAGGAATAAGGTGAAG

   Matching with '--bol --mismatches 1':
              GATTTACTATGTAAAGATAGAAGGAATAAGGTGAAG GATCT (1 mismatch, BC1) ATCGT (4 mismatches,  BC2)  GTGAT  (3
              mismatches, BC3) TGTCT (3 mismatches, BC4)

       This  sequence  will  be  classified  as  'BC1'  (it  has  the  lowest  mismatch count).  If '--exact' or
       '--mismatches 0' were specified, this sequence would be classified as 'unmatched' (because, although  BC1
       had the lowest mismatch count, it is above the maximum allowed mismatches).

       Matching with '--eol' (end of line) does the same, but from the other side of the sequence.

       ** With partial matching (very similar to indels):

       Same  as  above,  with  the  following addition: barcodes are also checked for partial overlap (number of
       allowed non-overlapping bases is '--partial N').

       Example: Input sequence is ATTTACTATGTAAAGATAGAAGGAATAAGGTGAAG (Same as above, but note the  missing  'G'
       at the beginning.)

   Matching (without partial overlapping) against BC1 yields 4 mismatches:
              ATTTACTATGTAAAGATAGAAGGAATAAGGTGAAG GATCT (4 mismatches)

   Partial overlapping would also try the following match:

       -ATTTACTATGTAAAGATAGAAGGAATAAGGTGAAG

              GATCT (1 mismatch)

       Note: scoring counts a missing base as a mismatch, so the final mismatch count is 2 (1 'real' mismatch, 1
       'missing  base'  mismatch).  If running with '--mismatches 2' (meaning allowing upto 2 mismatches) - this
       seqeunce will be classified as BC1.

SEE ALSO

       The quality of this automatically generated manpage might be insufficient.  It is suggested to visit

              http://hannonlab.cshl.edu/fastx_toolkit/commandline.html

       to get a better layout as well as an overview about connected FASTX tools.

fastx_barcode_splitter.pl 0.0.14                   August 2015                      FASTX_BARCODE_SPLITTER.PL(1)