xenial (5) faidx.5.gz

NAME

       faidx - an index enabling random access to FASTA files

SYNOPSIS

       file.fa.fai, file.fasta.fai

DESCRIPTION

       Using an fai index file in conjunction with a FASTA file containing reference sequences enables efficient
       access to arbitrary regions within those reference sequences.  The index  file  typically  has  the  same
       filename as the corresponding FASTA file, with .fai appended.

       An fai index file is a text file consisting of lines each with five TAB-delimited columns:

       NAME        Name of this reference sequence
       LENGTH      Total length of this reference sequence, in bases
       OFFSET      Offset within the FASTA file of this sequence's first base
       LINEBASES   The number of bases on each line
       LINEWIDTH   The number of bytes in each line, including the newline

       The  NAME  and  LENGTH columns contain the same data as would appear in the SN and LN fields of a SAM @SQ
       header for the same reference sequence.

       The OFFSET column contains the offset within the FASTA file, in bytes starting from zero,  of  the  first
       base  of  this  reference  sequence,  i.e.,  of the character following the newline at the end of the ">"
       header line.  Typically the lines of a fai index  file  appear  in  the  order  in  which  the  reference
       sequences appear in the FASTA file, so .fai files are typically sorted according to this column.

       The  LINEBASES  column  contains  the number of bases in each of the sequence lines that form the body of
       this reference sequence, apart from the final line which may be shorter.  The LINEWIDTH  column  contains
       the  number  of  bytes in each of the sequence lines (except perhaps the final line), thus differing from
       LINEBASES in that it also counts the bytes forming the line terminator.

   FASTA Files
       In order to be indexed with samtools faidx, a FASTA file must be a text file of the form

              >name [description...]
              ATGCATGCATGCATGCATGCATGCATGCAT
              GCATGCATGCATGCATGCATGCATGCATGC
              ATGCAT
              >name [description...]
              ATGCATGCATGCAT
              GCATGCATGCATGC
              [...]

       In particular, each reference sequence must be "well-formatted", i.e., all of its sequence lines must  be
       the  same  length,  apart  from  the final sequence line which may be shorter.  (While this sequence line
       length must be the same within each sequence, it may vary between different reference  sequences  in  the
       same FASTA file.)

       This  also  means that although the FASTA file may have Unix- or Windows-style or other line termination,
       the newline characters present must be consistent, at least within each reference sequence.

       The samtools implementation uses the first word of the ">" header  line  text  (i.e.,  up  to  the  first
       whitespace  character)  as  the  NAME  column.   At  present,  there may be no whitespace between the ">"
       character and the name.

EXAMPLE

       For example, given this FASTA file

              >one
              ATGCATGCATGCATGCATGCATGCATGCAT
              GCATGCATGCATGCATGCATGCATGCATGC
              ATGCAT
              >two another chromosome
              ATGCATGCATGCAT
              GCATGCATGCATGC

       formatted with Unix-style (LF) line termination, the corresponding fai index would be

              one   66    5   30   31
              two   28   98   14   15

       If the FASTA file were formatted with Windows-style (CR-LF) line termination, the fai index would be

              one   66     6   30   32
              two   28   103   14   16

SEE ALSO

       samtools(1)

       http://en.wikipedia.org/wiki/FASTA_format
              Further description of the FASTA format