NAME

       faidx - an index enabling random access to FASTA files

SYNOPSIS

       file.fa.fai, file.fasta.fai

DESCRIPTION

       Using an fai index file in conjunction with a FASTA file containing reference sequences enables efficient
       access  to  arbitrary  regions  within  those reference sequences.  The index file typically has the same
       filename as the corresponding FASTA file, with .fai appended.

       An fai index file is a text file consisting of lines each with five TAB-delimited columns:
       NAME        Name of this reference sequence
       LENGTH      Total length of this reference sequence, in bases
       OFFSET      Offset within the FASTA file of this sequence's first base
       LINEBASES   The number of bases on each line
       LINEWIDTH   The number of bytes in each line, including the newline

       The NAME and LENGTH columns contain the same data as would appear in the SN and LN fields of  a  SAM  @SQ
       header for the same reference sequence.

       The  OFFSET  column  contains the offset within the FASTA file, in bytes starting from zero, of the first
       base of this reference sequence, i.e., of the character following the newline  at  the  end  of  the  ">"
       header  line.   Typically  the  lines  of  a  fai  index  file appear in the order in which the reference
       sequences appear in the FASTA file, so .fai files are typically sorted according to this column.

       The LINEBASES column contains the number of bases in each of the sequence lines that  form  the  body  of
       this  reference  sequence, apart from the final line which may be shorter.  The LINEWIDTH column contains
       the number of bytes in each of the sequence lines (except perhaps the final line),  thus  differing  from
       LINEBASES in that it also counts the bytes forming the line terminator.

   FASTA Files
       In order to be indexed with samtools faidx, a FASTA file must be a text file of the form

              >name [description...]
              ATGCATGCATGCATGCATGCATGCATGCAT
              GCATGCATGCATGCATGCATGCATGCATGC
              ATGCAT
              >name [description...]
              ATGCATGCATGCAT
              GCATGCATGCATGC
              [...]

       In  particular, each reference sequence must be "well-formatted", i.e., all of its sequence lines must be
       the same length, apart from the final sequence line which may be  shorter.   (While  this  sequence  line
       length  must  be  the same within each sequence, it may vary between different reference sequences in the
       same FASTA file.)

       This also means that although the FASTA file may have Unix- or Windows-style or other  line  termination,
       the newline characters present must be consistent, at least within each reference sequence.

       The  samtools  implementation  uses  the  first  word  of the ">" header line text (i.e., up to the first
       whitespace character, having skipped any initial whitespace after the ">") as the NAME column.

EXAMPLE

       For example, given this FASTA file

              >one
              ATGCATGCATGCATGCATGCATGCATGCAT
              GCATGCATGCATGCATGCATGCATGCATGC
              ATGCAT
              >two another chromosome
              ATGCATGCATGCAT
              GCATGCATGCATGC

       formatted with Unix-style (LF) line termination, the corresponding fai index would be
              one   66    5   30   31
              two   28   98   14   15

       If the FASTA file were formatted with Windows-style (CR-LF) line termination, the fai index would be
              one   66     6   30   32
              two   28   103   14   16

SEE ALSO

       samtools(1)

       http://en.wikipedia.org/wiki/FASTA_format
              Further description of the FASTA format

htslib                                             August 2015                                          faidx(5)