plucky (3) Bio::PrimarySeq.3pm.gz

NAME
Bio::PrimarySeq - Bioperl lightweight sequence object
SYNOPSIS
# Bio::SeqIO for file reading, Bio::DB::GenBank for # database reading use Bio::Seq; use Bio::SeqIO; use Bio::DB::GenBank; # make from memory $seqobj = Bio::PrimarySeq->new ( -seq => 'ATGGGGTGGGCGGTGGGTGGTTTG', -id => 'GeneFragment-12', -accession_number => 'X78121', -alphabet => 'dna', -is_circular => 1, ); print "Sequence ", $seqobj->id(), " with accession ", $seqobj->accession_number, "\n"; # read from file $inputstream = Bio::SeqIO->new( -file => "myseq.fa", -format => 'Fasta', ); $seqobj = $inputstream->next_seq(); print "Sequence ", $seqobj->id(), " and desc ", $seqobj->desc, "\n"; # to get out parts of the sequence. print "Sequence ", $seqobj->id(), " with accession ", $seqobj->accession_number, " and desc ", $seqobj->desc, "\n"; $string = $seqobj->seq(); $string2 = $seqobj->subseq(1,40);
DESCRIPTION
PrimarySeq is a lightweight sequence object, storing the sequence, its name, a computer-useful unique name, and other fundamental attributes. It does not contain sequence features or other information. To have a sequence with sequence features you should use the Seq object which uses this object. Although new users will use Bio::PrimarySeq a lot, in general you will be using it from the Bio::Seq object. For more information on Bio::Seq see Bio::Seq. For interest you might like to know that Bio::Seq has-a Bio::PrimarySeq and forwards most of the function calls to do with sequence to it (the has-a relationship lets us get out of a otherwise nasty cyclical reference in Perl which would leak memory). Sequence objects are defined by the Bio::PrimarySeqI interface, and this object is a pure Perl implementation of the interface. If that's gibberish to you, don't worry. The take home message is that this object is the bioperl default sequence object, but other people can use their own objects as sequences if they so wish. If you are interested in wrapping your own objects as compliant Bioperl sequence objects, then you should read the Bio::PrimarySeqI documentation The documentation of this object is a merge of the Bio::PrimarySeq and Bio::PrimarySeqI documentation. This allows all the methods which you can call on sequence objects here.
FEEDBACK
Mailing Lists User feedback is an integral part of the evolution of this and other Bioperl modules. Send your comments and suggestions preferably to one of the Bioperl mailing lists. Your participation is much appreciated. bioperl-l@bioperl.org - General discussion http://bioperl.org/wiki/Mailing_lists - About the mailing lists Support Please direct usage questions or support issues to the mailing list: bioperl-l@bioperl.org rather than to the module maintainer directly. Many experienced and reponsive experts will be able look at the problem and quickly address it. Please include a thorough description of the problem with code and data examples if at all possible. Reporting Bugs Report bugs to the Bioperl bug tracking system to help us keep track the bugs and their resolution. Bug reports can be submitted via the web: https://github.com/bioperl/bioperl-live/issues
AUTHOR - Ewan Birney
Email birney@ebi.ac.uk
APPENDIX
The rest of the documentation details each of the object methods. Internal methods are usually preceded with a _ new Title : new Usage : $seqobj = Bio::PrimarySeq->new( -seq => 'ATGGGGGTGGTGGTACCCT', -id => 'human_id', -accession_number => 'AL000012', ); Function: Returns a new primary seq object from basic constructors, being a string for the sequence and strings for id and accession_number. Note that you can provide an empty sequence string. However, in this case you MUST specify the type of sequence you wish to initialize by the parameter -alphabet. See alphabet() for possible values. Returns : a new Bio::PrimarySeq object Args : -seq => sequence string -ref_to_seq => ... or reference to a sequence string -display_id => display id of the sequence (locus name) -accession_number => accession number -primary_id => primary id (Genbank id) -version => version number -namespace => the namespace for the accession -authority => the authority for the namespace -description => description text -desc => alias for description -alphabet => skip alphabet guess and set it to dna, rna or protein -id => alias for display id -is_circular => boolean to indicate that sequence is circular -direct => boolean to directly set sequences. The next time -seq, seq() or -ref_to_seq is use, the sequence will not be validated. Be careful with this... -nowarnonempty => boolean to avoid warning when sequence is empty seq Title : seq Usage : $string = $seqobj->seq(); Function: Get or set the sequence as a string of letters. The case of the letters is left up to the implementer. Suggested cases are upper case for proteins and lower case for DNA sequence (IUPAC standard), but you should not rely on this. An error is thrown if the sequence contains invalid characters: see validate_seq(). Returns : A scalar Args : - Optional new sequence value (a string) to set - Optional alphabet (it is guessed by default) validate_seq Title : validate_seq Usage : if(! $seqobj->validate_seq($seq_str) ) { print "sequence $seq_str is not valid for an object of alphabet ",$seqobj->alphabet, "\n"; } Function: Test that the given sequence is valid, i.e. contains only valid characters. The allowed characters are all letters (A-Z) and '-','.', '*','?','=' and '~'. Spaces are not valid. Note that this implementation does not take alphabet() into account and that empty sequences are considered valid. Returns : 1 if the supplied sequence string is valid, 0 otherwise. Args : - Sequence string to be validated - Boolean to optionally throw an error if the sequence is invalid subseq Title : subseq Usage : $substring = $seqobj->subseq(10,40); $substring = $seqobj->subseq(10,40,'nogap'); $substring = $seqobj->subseq(-start=>10, -end=>40, -replace_with=>'tga'); $substring = $seqobj->subseq($location_obj); $substring = $seqobj->subseq($location_obj, -nogap => 1); Function: Return the subseq from start to end, where the first sequence character has coordinate 1 number is inclusive, ie 1-2 are the first two characters of the sequence. The given start coordinate has to be larger than the end, even if the sequence is circular. Returns : a string Args : integer for start position integer for end position OR Bio::LocationI location for subseq (strand honored) Specify -NOGAP=>1 to return subseq with gap characters removed Specify -REPLACE_WITH=>$new_subseq to replace the subseq returned with $new_subseq in the sequence object length Title : length Usage : $len = $seqobj->length(); Function: Get the stored length of the sequence in number of symbols (bases or amino acids). In some circumstances, you can also set this attribute: 1. For empty sequences, you can set the length to anything you want: my $seqobj = Bio::PrimarySeq->new( -length => 123 ); my $len = $seqobj->len; # 123 2. To save memory when using very long sequences, you can set the length of the sequence to the length of the sequence (and nothing else): my $seqobj = Bio::PrimarySeq->new( -seq => 'ACGT...' ); # 1 Mbp sequence # process $seqobj... then after you're done with it $seqobj->length($seqobj->length); $seqobj->seq(undef); # free memory! my $len = $seqobj->len; # 1 Mbp Note that if you set seq() to a value other than undef at any time, the length attribute will be reset. Returns : integer representing the length of the sequence. Args : Optionally, the value on set display_id Title : display_id or display_name Usage : $id_string = $seqobj->display_id(); Function: Get or set the display id, aka the common name of the sequence object. The semantics of this is that it is the most likely string to be used as an identifier of the sequence, and likely to have "human" readability. The id is equivalent to the ID field of the GenBank/EMBL databanks and the id field of the Swissprot/sptrembl database. In fasta format, the >(\S+) is presumed to be the id, though some people overload the id to embed other information. Bioperl does not use any embedded information in the ID field, and people are encouraged to use other mechanisms (accession field for example, or extending the sequence object) to solve this. With the new Bio::DescribeableI interface, display_name aliases to this method. Returns : A string for the display ID Args : Optional string for the display ID to set accession_number Title : accession_number or object_id Usage : $unique_key = $seqobj->accession_number; Function: Returns the unique biological id for a sequence, commonly called the accession_number. For sequences from established databases, the implementors should try to use the correct accession number. Notice that primary_id() provides the unique id for the implementation, allowing multiple objects to have the same accession number in a particular implementation. For sequences with no accession number, this method should return "unknown". [Note this method name is likely to change in 1.3] With the new Bio::IdentifiableI interface, this is aliased to object_id Returns : A string Args : A string (optional) for setting primary_id Title : primary_id Usage : $unique_key = $seqobj->primary_id; Function: Returns the unique id for this object in this implementation. This allows implementations to manage their own object ids in a way the implementation can control clients can expect one id to map to one object. For sequences with no natural primary id, this method should return a stringified memory location. Returns : A string Args : A string (optional, for setting) alphabet Title : alphabet Usage : if( $seqobj->alphabet eq 'dna' ) { # Do something } Function: Get/set the alphabet of sequence, one of 'dna', 'rna' or 'protein'. This is case sensitive. This is not called <type> because this would cause upgrade problems from the 0.5 and earlier Seq objects. Returns : a string either 'dna','rna','protein'. NB - the object must make a call of the type - if there is no alphabet specified it has to guess. Args : optional string to set : 'dna' | 'rna' | 'protein' desc Title : desc or description Usage : $seqobj->desc($newval); Function: Get/set description of the sequence. 'description' is an alias for this for compliance with the Bio::DescribeableI interface. Returns : value of desc (a string) Args : newvalue (a string or undef, optional) can_call_new Title : can_call_new Usage : Function: Example : Returns : true Args : id Title : id Usage : $id = $seqobj->id(); Function: This is mapped on display_id Example : Returns : Args : is_circular Title : is_circular Usage : if( $seqobj->is_circular) { # Do something } Function: Returns true if the molecule is circular Returns : Boolean value Args : none
Methods for Bio::IdentifiableI compliance
object_id Title : object_id Usage : $string = $seqobj->object_id(); Function: Get or set a string which represents the stable primary identifier in this namespace of this object. For DNA sequences this is its accession_number, similarly for protein sequences. This is aliased to accession_number(). Returns : A scalar Args : Optional object ID to set. version Title : version Usage : $version = $seqobj->version(); Function: Get or set a number which differentiates between versions of the same object. Higher numbers are considered to be later and more relevant, but a single object described the same identifier should represent the same concept. Returns : A number Args : Optional version to set. authority Title : authority Usage : $authority = $seqobj->authority(); Function: Get or set a string which represents the organisation which granted the namespace, written as the DNS name of the organisation (eg, wormbase.org). Returns : A scalar Args : Optional authority to set. namespace Title : namespace Usage : $string = $seqobj->namespace(); Function: Get or set a string representing the name space this identifier is valid in, often the database name or the name describing the collection. Returns : A scalar Args : Optional namespace to set.
Methods for Bio::DescribableI compliance
This comprises of display_name and description. display_name Title : display_name Usage : $string = $seqobj->display_name(); Function: Get or set a string which is what should be displayed to the user. The string should have no spaces (ideally, though a cautious user of this interface would not assume this) and should be less than thirty characters (though again, double checking this is a good idea). This is aliased to display_id(). Returns : A string for the display name Args : Optional string for the display name to set. description Title : description Usage : $string = $seqobj->description(); Function: Get or set a text string suitable for displaying to the user a description. This string is likely to have spaces, but should not have any newlines or formatting - just plain text. The string should not be greater than 255 characters and clients can feel justified at truncating strings at 255 characters for the purposes of display. This is aliased to desc(). Returns : A string for the description Args : Optional string for the description to set.
Methods Inherited from Bio::PrimarySeqI
These methods are available on Bio::PrimarySeq, although they are actually implemented on Bio::PrimarySeqI revcom Title : revcom Usage : $rev = $seqobj->revcom(); Function: Produces a new Bio::SeqI implementing object which is the reversed complement of the sequence. For protein sequences this throws an exception of "Sequence is a protein. Cannot revcom". The id is the same id as the original sequence, and the accession number is also identical. If someone wants to track that this sequence has be reversed, it needs to define its own extensions. To do an inplace edit of an object you can go: $seqobj = $seqobj->revcom(); This of course, causes Perl to handle the garbage collection of the old object, but it is roughly speaking as efficient as an inplace edit. Returns : A new (fresh) Bio::SeqI object Args : none trunc Title : trunc Usage : $subseq = $myseq->trunc(10,100); Function: Provides a truncation of a sequence, Returns : A fresh Bio::SeqI implementing object. Args : Numbers for the start and end positions
Internal methods
These are internal methods to PrimarySeq _guess_alphabet Title : _guess_alphabet Usage : Function: Automatically guess and set the type of sequence: dna, rna, protein or '' if the sequence was empty. This method first removes dots (.), dashes (-) and question marks (?) before guessing the alphabet using the IUPAC conventions for ambiguous residues. Since the DNA and RNA characters are also valid characters for proteins, there is no foolproof way of determining the right alphabet. This is our best guess only! Returns : string 'dna', 'rna', 'protein' or ''. Args : none