NAME

       faidx - an index enabling random access to FASTA files

SYNOPSIS

       file.fa.fai, file.fasta.fai

DESCRIPTION

       Using  an  fai  index file in conjunction with a FASTA file containing reference sequences
       enables efficient access to arbitrary regions within those reference sequences.  The index
       file typically has the same filename as the corresponding FASTA file, with .fai appended.

       An fai index file is a text file consisting of lines each with five TAB-delimited columns:

       NAME        Name of this reference sequence
       LENGTH      Total length of this reference sequence, in bases
       OFFSET      Offset within the FASTA file of this sequence's first base
       LINEBASES   The number of bases on each line
       LINEWIDTH   The number of bytes in each line, including the newline

       The  NAME and LENGTH columns contain the same data as would appear in the SN and LN fields
       of a SAM @SQ header for the same reference sequence.

       The OFFSET column contains the offset within the FASTA file, in bytes starting from  zero,
       of the first base of this reference sequence, i.e., of the character following the newline
       at the end of the ">" header line.  Typically the lines of a fai index file appear in  the
       order  in  which  the  reference  sequences  appear  in  the FASTA file, so .fai files are
       typically sorted according to this column.

       The LINEBASES column contains the number of bases in each of the sequence lines that  form
       the  body of this reference sequence, apart from the final line which may be shorter.  The
       LINEWIDTH column contains the number of bytes  in  each  of  the  sequence  lines  (except
       perhaps  the  final  line), thus differing from LINEBASES in that it also counts the bytes
       forming the line terminator.

   FASTA Files
       In order to be indexed with samtools faidx, a FASTA file must be a text file of the form

              >name [description...]
              ATGCATGCATGCATGCATGCATGCATGCAT
              GCATGCATGCATGCATGCATGCATGCATGC
              ATGCAT
              >name [description...]
              ATGCATGCATGCAT
              GCATGCATGCATGC
              [...]

       In particular, each reference sequence must be "well-formatted", i.e., all of its sequence
       lines  must  be  the same length, apart from the final sequence line which may be shorter.
       (While this sequence line length must be the  same  within  each  sequence,  it  may  vary
       between different reference sequences in the same FASTA file.)

       This also means that although the FASTA file may have Unix- or Windows-style or other line
       termination, the newline characters present must  be  consistent,  at  least  within  each
       reference sequence.

       The  samtools  implementation uses the first word of the ">" header line text (i.e., up to
       the first whitespace character)  as  the  NAME  column.   At  present,  there  may  be  no
       whitespace between the ">" character and the name.

EXAMPLE

       For example, given this FASTA file

              >one
              ATGCATGCATGCATGCATGCATGCATGCAT
              GCATGCATGCATGCATGCATGCATGCATGC
              ATGCAT
              >two another chromosome
              ATGCATGCATGCAT
              GCATGCATGCATGC

       formatted with Unix-style (LF) line termination, the corresponding fai index would be

              one   66    5   30   31
              two   28   98   14   15

       If  the  FASTA  file  were  formatted with Windows-style (CR-LF) line termination, the fai
       index would be

              one   66     6   30   32
              two   28   103   14   16

SEE ALSO

       samtools(1)

       http://en.wikipedia.org/wiki/FASTA_format
              Further description of the FASTA format